The Korean Society of Pesticide Science

Current Issue

The Korean Journal of Pesticide Science - Vol. 22 , No. 4

[ ORIGINAL ARTICLES ]
The Korean Journal of Pesticide Science - Vol. 22, No. 4, pp.276-283
Abbreviation: Korean J. Pestic. Sci.
ISSN: 1226-6183 (Print) 2287-2051 (Online)
Print publication date 31 Dec 2018
Received 4 Oct 2018 Revised 6 Nov 2018 Accepted 8 Nov 2018
DOI: https://doi.org/10.7585/kjps.2018.22.4.276

온탕침지와 황토유황합제의 유기농 수박종자 소독효과 검정
김민정 ; 심창기* ; 김용기 ; 고병구 ; 변영웅 ; 박종호 ; 한은정
국립농업과학원 농업환경부 유기농업과

Evaluation of Hot Water Treatment and Loess-Sulfur Mixture for Disinfection of Watermelon Seeds for Organic Farming
Min-Jeong Kim ; Chang-Ki Shim* ; Yong-Ki Kim ; Byeong-Gu Ko ; Young-Woong Byun ; Jong-Ho Park ; Eun-Jung Han
Organic Agriculture Division, National Institute of Agricultural Sciences, RDA, Wanju 55365, Korea
Correspondence to : *Email: ckshim@korea.kr

Funding Information ▼

초록

본 연구의 목적은 온탕침지와 pH 교정황토유황합제 처리에 의한 수박 종자의 곰팡이나 세균의 소독효과와 입묘율에 미치는 영향을 검정하고자 하였다. 수박종자에는 곰팡이인 Aspergillus niger와 세균인 Pseudomonas syringae가 주로 감염되어 있었다. 온탕침지 처리 온도와 시간이 증가함에 따라 곰팡이나 세균의 소독효과는 증가하지만 수박의 입묘율은 급격히 감소하였다. 특히 55oC 온탕침지 조건에서 곰팡이와 세균의 소독효과는 100%이었지만 수박의 입묘율은 43.3% 이하로 나타났다. 수박종자를 소독할 경우 pH 교정황토유황합제를 혼용 처리하면 온탕침지 단독으로 처리하는 것보다 낮은 온도와 짧은 시간에서 높은 소독효과와 입묘율을 가져올 수 있었다. 온탕침지와 pH 교정황토유황합제를 이용한 무소독 수박종자의 적정한 처리조건으로 45oC 온탕에서 20분 침지 후, 0.05%나 0.1% pH 교정황토유황합제에 처리하거나, 50oC 온탕에서 15분 침지 후 0.05% pH 교정황토유황합제에 처리할 경우 곰팡이와 세균의 살균효과는 86.7% 이상이고 입묘율은 93.3%이었다.

Abstract

The watermelon seeds were mainly infected with pathogenic fungus and bacterium, Aspergillus niger and Pseudomonas syringae. The purpose of this study was to investigate the effects of hot water treatment and pH adjusted loess-sulfur mixture on the disinfection effect and emergence rate of watermelon seeds. As the temperature and time of hot water treatment increased, the disinfection effect of fungi and bacteria on watermelon seeds, but the emergence rate of watermelon decreased rapidly. Especially, the disinfection effect of fungi and bacteria was 100% under 55oC hot water treatment conditions, but the emergence rate of watermelon was lower than 43.3%. In the case of disinfection of watermelon seeds, combined treated hot water and pH adjusted loess-sulfur mixture resulted in higher disinfection effect and the emergence at lower temperature and shorter time than that of hot water alone. The optimum treatment conditions of watermelon seeds using hot water and pH adjusted loess-sulfur mixture were as follows: watermelon seeds immersed in hot water at 45oC for 20 min, co-treated with 0.05% or 0.1% pH adjusted loess-sulfur mixture, or in 50oC hot water for 15 min and then co-treated with 0.05% pH adjusted loess-sulfur mixture, the disinfection effect of fungi and bacteria was 86.7% or more and the emergence rate was 93.3%. As a result, the combined treatment with hot water and pH adjusted loess-sulfur mixture can be developed by the disinfection techniques for organic watermelon seed.


Keywords: Disinfection, Hot water treatment, Loess sulfur mixture, Organic watermelon seed
키워드: 소독, 온탕침지, 황토유황, 유기농수박종자

서 론

2012년 이후 국내 친환경농산물 인증면적은 지속적으로 감소하여 2015년까지 연평균 12.3%로 감소하였다. 그러나 2016년 다시 증가세로 전환되어 친환경농산물 인증면적은 2015년 대비 약 5.8% 증가한 79.5천 ha이며 출하량은 전년 대비 24.2% 증가한 571.2천 톤으로 보고되었다(Sung et al., 2017).

유기농업의 실천에 있어 유기종자의 사용은 기본이며 우리나라 친환경농어업육성법 시행령 시행규칙(MAF, 2017)에도 이를 명시하고 있다. 그러나 최근까지도 대부분의 유기채소 재배농가에서는 유기종자를 구할 수 없기 때문에 화학적으로 소독된 종자를 사용해 왔다.

종자는 재배기간 중에 다양한 병원체에 의해 오염 또는 병원균에 감염되어 있을 수 있기 때문에 식물병원균을 가지고 있는 종자의 비율이 낮아도 포장에서 병으로 발생할 경우 빠른 전염원의 역할과 농작물 생산에 큰 피해를 주게 된다(Noble and Richardson, 1968; Gitaitis and Walcott, 2007).

유기농업에서 활용할 수 있는 종자소독 방법은 물리적인 방법으로 온탕침지법, 냉수온탕침지법, 건열처리 등이 있는데, 온탕침지법과 냉수온탕침지법은 주로 식량작물 종자에 이용되었고 건열처리는 주로 채소작물 종자에 이용되었다(Choi et al., 2001).

온탕침지법은 가장 오래된 물리적인 종자소독 방법으로 19세기말부터 보리, 밀의 비린깜부기병(Ustilago nuda) (Jensen, 1988)과 귀리 겉깜부기병(Ustilago avenae)을 예방하기 위해 개발되었으며 미국에서는 1920년대에 배추뿌리 썩음병(Phoma lingam) 방제기술로 개발되었으며(Gabrielson, 1983) 최근까지 당근(Hermansen et al., 2000), 시금치(du Toit and Hernandez-Perez, 2005), 토마토(Kasselaki et al., 2008) 등 다양한 작물의 종자감염 병원균을 방제하는 기술로 알려져 있다(Nega et al., 2003). 국내에서도 온탕침지법은 오래 전부터 벼키다리병(Gibberella fujikuroi) 방제와 맥류 깜부기병 방제를 위해 널리 활용되어 왔으며 유황은 인류가 작물로부터 발생하는 병해충을 방제하고자 사용한 천연물질 중의 하나이다. 유황은 유기농업자재로서 미국, 유럽, 우리나라 등지에서 사용이 허용되어 있다(EPA, 1991; Ahn, 2010; OMRI 2012). 우리나라에서도 친환경 유기농 병해충 방제목적으로 사용할 수 있는 친환경유기농자재의 원료로 허용되어 있으며, pH교정황토유황합제에 대한 급성경구독 성시험은 결과 LD50이 2,000 mg/kg bw 이상이었으며, 급성경피독성은 4,000 mg/kg bw 이상인 저자극성으로 분류되었다. 또한 피부 및 안점막자극성 시험 결과에서도 모두 저자극성으로 분류되어 친환경 유기농업자재로 사용하는데 적합한 것으로 보고하였다(Paik et al., 2012).

본 연구는 국내에서 재배되는 대표적인 박과채소 작물인 수박 종자를 대상으로 유기농업에서 활용 가능한 유기농업자재와 온탕침지법을 이용한 종자소독 효과를 구명하여 유기종자 생산 및 유기농업 실천농가에 보급하고자 수행하였다.


재료 및 방법
시험재료

본 시험에서 사용한 유기농 수박종자는 경상북도 농업기술원 유기농업연구소 유기재배 포장에서 유기농으로 재배한 후 채종하여 소독하지 않고 보관 중인 것을 분양 받아 사용하였다. 유기종자 소독효과 증진을 위해 사용한 황토유황합제를 제조하기 위해 필요한 순도98% 가성소다(NaOH, (주) 영진화학), 유황분말((주)미원화학), 황토분말(참솔황토), 카리장석((주) 가딘), 천일염, 등은 시중에서 구입하여 사용하였다.

황토유황합제 제조

본 시험에서 사용한 개선황토유황합제는 기존에 농가에서 자가 제조하여 사용하던 황토유황합제의 제조법을 변형하여 제조하였다. 100 L 용량의 내열성 고무재질 용기에 가성소다(NaOH) 15 kg을 먼저 넣고 유황 덩어리를 잘 부셔서 가루형태로 만든 유황분말 25 kg을 넣어 골고루 섞어 주었다. 여기에 천일염 1.5 kg, 황토분말 500 g, 카리장석 500 g을 각각 넣어 다시 한번 전체 내용물이 골고루 섞일 수 있도록 혼합하였다. 미리 준비한 100 L의 물 중에서 30 L의 물을 먼저 통에 조심스럽게 부어주면 가성소다에 의한 발열반응으로 107oC 이상 끓어오르는 현상이 3회 이상 반복되도록 물을 조금씩 부어가며 발열반응을 유지 하였다. 발열반응이 더 이상 일어나지 않으면 전체 용량이 100 L가 되도록 나머지 물을 첨가한 후 5주간 서늘한 곳에 보관한 후 실험에 사용하였다.

종자감염균 조사 및 분리

무소독 수박종자에 감염된 미생물의 종류와 감염 정도를 파악하고자 분양 받은 종자에서 임의적으로 50립씩 3반복으로 추출하여 직경 14 cm의 물한천배지(Water agar)에 25립씩 3반복으로 균일하게 치상하여 25oC 항온기에 두었다. 곰팡이나 세균의 발생은 7일간 육안으로 관찰하였으며, 감염된 곰팡이와 세균은 각각 감자한천배지(Potato dextrose agar)와 TSA배지(Trypticase soy agar)에 3회 계대배양하여 순수 분리하였다. 곰팡이는 형태적인 특징을 광학현미경으로 관찰하여 불완전균 분류도감을 참조하였다(Barnett and Hunter, 1998).

분리한 곰팡이와 세균의 분자생물학적으로 간이동정을 하기 위하여 곰팡이는 β-tubulin유전자를 분석하였으며, 세균은 16S–23S rRNA gene intergenic spacer (ITS1) 유전자를 분석하여 동정하였다. 시험에 사용된 곰팡이와 세균의 β-tubulin과 16s rDNA 유전자를 증폭하기 위한 oligo primer의 정보와 PCR 증폭에 필요한 온도조건은 Table 1과 같다. DNA 염기서열 분석은 Sol Gent Co., Ltd. (Daejeon, Korea)에 의뢰하였다.

Table 1. 
PCR primer sets and corresponding amplification β-tubulin and 16S–23S rRNA gene intergenic spacer
Target gene primer DNA sequence (5'-3') Annealing Tm (oC) Citeated
β-tubulin Bt2a GGTAACCAAATCGGTGCTGCTTTC 58 Glass N. L. and G. C. Donaldson (1995)
Bt2b ACCCTCAGTGTAGTGACCCTTGGC
ITS 1 D21 AGCCGTAGGGGAACCTGCGG 60 Manceau and Horvais (1997)
D22 TGACTGCCAAGGCATCCACC

온탕침지 및 pH 교정황토유황함제 처리

온탕침지와 pH교정황토유황합제 처리에 의한 수박종자 소독효과를 검정하기 위하여 Lee 등(2007)의 방법을 병행하여 실시하였다. 무소독 수박종자 20립을 3반복으로 멸균 티백에 넣어서 미리 데워둔 45oC, 50oC, 55oC 항온수조(Vision Sci. Ltd., Korea)에 10분부터 5분 간격으로 30분까지 침지 처리하였다. 처리가 끝난 종자팩은 온탕침지 즉시, pH교정황토유황합제 원액을 실온의 살균수에 0.05% (v/v), 0.1% (v/v), 0.2% (v/v), 0.4% (v/v), 1.0% (v/v), 2.0% (v/v)로 희석한 용액에 10분간 침지 후, 건져내어 무균상 안에서 멸균된 filter paper (Whatman No. 3) 위에 펼쳐놓고 풍건하여 종자 표면의 물기를 제거한 후 시험에 사용하였다.

온탕침지 및 pH 교정황토유황함제 처리에 따른 입묘율 조사

위와 같은 방법으로 온탕침지와 pH 교정황토유황합제로 소독한 수박종자의 입묘율 검정은 국립농업과학원 유기농업과 유리온실에서 수행하였다. 육묘용 상토는 ‘원예용 바로커’를 사용하였으며 원예용 원형포트(20.5 × 20.5 × 16.0 cm)에 20립씩 3반복으로 파종한 후 21일까지 일반적인 재배방법에 따라 관리하면서 수박종자의 입묘율을 조사하였다.

통계처리

온탕침지 처리조건 및 pH 교정황토유황합제의 농도에 따른 수박종자의 곰팡이와 세균의 살균효과와 소독처리한 수박종자의 온실에서 입묘율의 조사는 각 처리마다 3반복으로 이루어졌으며 조사한 자료는 엑셀(Microsoft 2016)로 정리한 후 통계분석은 SAS 프로그램(SAS 9.1, SAS Institute, USA)을 이용하여 던컨의 다중범위검정(Duncan’s multiple range test)으로 분석하였다.


결과 및 고찰
종자감염균 조사 및 분리

곰팡이나 세균에 감염되지 않은 건전한 수박종자는 정상적으로 발아하여 건전한 떡잎과 뿌리를 형성하였으나(Fig. 1 A, B) 곰팡이나 세균이 심하게 감염된 수박종자의 경우 발아과정 중에 곰팡이가 생장하면서 종피와 뿌리에 검정색의 분생포자(Fig. 1 C, D)를 형성하거나 세균이 자란 종자 주위에는 투명한 연노란색의 균총을 형성하여 발아를 하지 못하게 하거나 뿌리를 갈변시키는 것으로 조사되었다(Fig. 1 E, F).


Fig. 1. 
Comparison healthy (A), (B) and contaminated watermelon seeds with Aspergillus niger (C), (D) and Pseudomonas syringae (E), (F).

유기적으로 재배한 수박으로부터 수확한 무소독 수박종자에 감염된 곰팡이와 세균의 종류와 감염 정도를 물한천배지(Water agar)에 치상하여 확인하였더니, 수박종자로부터 곰팡이는 Aspergillus sp., 한 종만 분리되었으며 조사한 수박 종자 중 80.5%가 감염되어 있는 것으로 조사되었다(Table 2). 수박종자로부터 분리한 세균은 형태적으로 Pseudomonas sp., 한 종만 분리되었으며 조사한 수박종마다 감염 정도의 차이는 있으나 69.8%가 감염되어 있는 것으로 나타났다(Table 2).

Table 2. 
The contamination percentage of seed borne fungus and bacterium in organic watermelon seed
Crop Fungus Bacterium
Species Percentage of contamination (%) Species Percentage of contamination (%)
Watermelon Aspergillus niger 80.5 ± 4.0x Pseudomonas syringae 69.8 ± 8.2
X : means ± standard error (n=60)

종자감염균의 분자생물학적 동정

수박종자로부터 분리한 Aspergillus sp.와 Pseudomonas sp.의 분자생물학적으로 동정을 하기 위하여 곰팡이의 β-tubulin 유전자와 세균의 16S–23S rRNA gene intergenic spacer (ITS1) 유전자를 분석한 결과, Aspergillus sp.로부터 증폭한 501 bp의 β-tubulin유전자의 단편은 Aspergillus niger culture CBS:513.88의 β-tubulin유전자 중 279번째와 780번째 유전자와 99%의 유전적 유사성을 나타내었다(Fig. 2). Pseudomonas sp.로부터 증폭한 545 bp의 ITS1 유전자의 단편은 Pseudomonas syringae pv. pisi strain ATCC 11043의 ITS1 전체 유전자 중 1516번째에서 2062번째까지 98%의 유전적 유사성을 가지며, Pseudomonas syringae pv. syringae strain 18 등과도 유전적 유사성을 98%를 보이는 것으로 나타내었다(Fig. 3)


Fig. 2. 
Taxonomic position of Aspergillus niger strains isolated from watermelon seed based on 501bp of partial β-tubulin gene. The sequences were first analyzed using the Tamura-Nei parameter distance calculation model with gamma-distributed substitution rates, which were then used to construct the Neighbor-Joining tree with MEGA version 5.2.2. Numbers under nodes are bootstrap values (>0.6).


Fig. 3. 
Taxonomic position of Pseudomonas syringae strains isolated from watermelon seed based on 545 bp of partial the 16S–23S rRNA gene intergenic spacer (ITS1). The sequences were first analyzed using the Tamura-Nei parameter distance calculation model with gamma-distributed substitution rates, which were then used to construct the Neighbor-Joining tree with MEGA version 5.2.2. Numbers under nodes are bootstrap values (>0.6).

따라서 수박종자로부터 분리한 곰팡이는 Aspergillus niger로 추정할 수 있으며, 수박종자로부터 분리된 세균은 아종(pv.)수준에서 명확하게 구분하기 어렵지만 Pseudomonas syringae 종인 것으로 추정할 수 있다. 수박종자로부터 분리된 세균의 자세한 동정은 추후 생리학적, 효소학적 동정을 통해 아종에 대한 구분이 필요할 것으로 생각된다.

Yoo et al. (1993)에 의하면 시중에서 유통되고 있는 주요 채소종자에서 전염되는 식물성 병원균을 분류, 동정한 결과 Alternaria sp., Aspergillus sp., Penicillium sp. 등 11종의 진균이 감염되어 있으며 작물에 따라 차이는 있으나 Alternaria sp. 우점하는 것으로 보고한 바 있다. 본 연구 결과에서는 무소독 수박종자에서 진균은 Aspergillus niger가 검출되었으며 감염비율이 높은 것으로 나타나 Yoo et al. (1993)의 보고와 유사한 결과를 보였다.

온탕침지와 pH 교정황토유황합제에 의한 수박종자의 곰팡이 소독효과

수박종자를 소독하기 위해 온탕침지 온도조건과 pH교정 황토유황합제의 농도에 따른 곰팡이의 소독효과에 미치는 영향을 조사하였더니, 3종류(45oC, 50oC, 55oC)의 온탕침지 온도 모두에서 처리시간이 증가함에 따라 곰팡이 소독효과가 증가하였다. 45oC 온탕침지 조건에서 20분 이상 처리할 경우 85.7% 이상의 곰팡이 소독효과를 보였으며 50oC 온탕침지 조건에서는 15분 이상 처리할 경우 80.0% 이상의 곰팡이 소독효과를 보였다. 특히, 55oC 온탕침지 조건에서는 10분 이상만 처리하여도 96.3% 이상의 높은 곰팡이 소독효과를 보였다(Table 3).

Table 3. 
Effect of a single- or combined treatment with loess sulfur mixture and hot water on disinfection rate of fungi on organic watermelon seeds under difference treatment time and temperature
Treatment Hot water Temperature (oC) Loess sulfur mixture (%) Disinfection rate of fungi (%)
10 min. 15 min. 20 min. 25 min. 30 min.
Single 45 0 40.0 c 73.3 c 85.7 b 87.7 c 93.3 b
50 0 73.3 b 80.0 b 86.0 b 93.3 b 93.3 b
55 0 96.3 a 97.7 a 100 a 100 a 100 a
Combined 45 0.05 60.0 e 83.3 d 90.0 c 92.3 b 100 a
0.1 73.3 d 83.3 d 93.3 b 96.0 b 100 a
0.2 80.0 c 80.0 c 96.7 c 100 c 100 a
0.4 93.3 b 93.3 b 100 a 100 c 100 a
1 100 a 100 a 100 a 100 c 100 a
2 100 a 100 a 100 a 100 c 100 a
50 0.05 86.7 c 86.7 c 100 a 100 a 100 a
0.1 93.3 b 93.3 b 100 a 100 a 100 a
0.2 93.3 b 100 a 100 a 100 a 100 a
0.4 100 a 100 a 100 a 100 a 100 a
1 100 a 100 a 100 a 100 a 100 a
2 100 a 100 a 100 a 100 a 100 a
55 0.05 100 a 100 a 100 a 100 a 100 a
0.1 100 a 100 a 100 a 100 a 100 a
0.2 100 a 100 a 100 a 100 a 100 a
0.4 100 a 100 a 100 a 100 a 100 a
1 100 a 100 a 100 a 100 a 100 a
2 100 a 100 a 100 a 100 a 100 a
Means followed by the same letter within a column are not significantly different at p<0.05 by Duncan’s multiple range tests.

3종류(45oC, 50oC, 55oC)의 온탕침지 후 pH 교정황토유황합제를 처리하였더니 동일한 처리시간에서 pH 교정황토유황합제의 농도가 증가할수록 온탕침지 단독 처리보다 높은 곰팡이 소독효과를 보였다. 45oC 온탕에서 20분 이상 침지 후 0.05% 이상의 pH 교정황토유황합제를 처리할 경우 90.0% 이상의 높은 곰팡이 소독효과를 보였다. 50oC 온탕에서 15분 이상 침지 후 0.1% 이상의 pH 교정황토유황합제를 처리할 경우 93.3% 이상의 높은 곰팡이 소독효과를 보였다. 55oC 온탕에서 10분 이상 침지 후 pH 교정황토유황합제를 처리할 경우 모든 농도의 pH 교정황토유황합제 처리에서 100%의 매우 높은 곰팡이 소독효과를 보였다(Table 3).

황토유황합제와 유사한 석회유황합제는 유럽의 유기농 사과재배 농가에서 가장 문제시되는 사과흑성병(Venturia inaequalis)과 응애 방제에 가장 효과적으로 사용할 수 있는 유기농자재 중의 하나로 알려져 있으며, 미국에서도 식물병원성 곰팡이 방제를 위해 사용되는 농자재 중의 하나로 알려져 있다(Trapman and Drechsler, 2000; Daniel et al., 2001).

Nega et al. (2003)은 온탕침지법에 의해 Alternaria sp., Phoma sp., Septoria sp.와 같은 종자전염성 곰팡이의 소독효과를 조사하였더니 50oC에서 20~30분 처리할 경우 80% 이상 방제할 수 있는 것으로 보도한 바 있다. 본 연구에서도 수박종자에 주요 감염균으로 조사된 Aspergillus nigerPseudomonas syringae를 온탕침지법과 pH 교정황토유황합제를 혼용처리할 경우 보다 효과적으로 방제할 수 있었다.

온탕침지와 pH 교정황토유황합제에 의한 수박종자의 세균 소독효과

처리온도와 처리시간에 따른 온탕침지 조건과 pH 교정황토유황합제의 농도(0.05~2.0%)에 따른 세균의 소독효과에 미치는 영향을 조사하였더니, 3종류(45oC, 50oC, 55oC)의 온탕침지 조건 모두에서 처리시간이 증가함에 따라 세균의 소독효과가 증가하였다. 45oC 온탕침지 조건에서 20분 이상 처리할 경우 80.0% 이상의 곰팡이 소독효과를 보인 반면 50oC 온탕침지 조건에서는 20분 이상 처리할 경우 93.3% 이상의 세균 소독효과를 보였다. 특히, 55oC 온탕침지 조건에서는 10분 이상 처리하여도 100%의 매우 높은 세균 소독효과를 보였다(Table 4).

Table 4. 
Effect of a single- or combined treatment with loess sulfur mixture and hot water on disinfection rate of bacteria on organic watermelon seeds under difference treatment time and temperature
Treatment Hot water Temperature (oC) Loess sulfur mixture (%) Disinfection rate of bacteria (%)
10 min. 15 min. 20 min. 25 min. 30 min.
Single 45 0 66.7 c 73.3 c 80.0 c 86.7 c 93.3 c
50 0 80.0 b 86.7 b 93.3 b 93.3 b 100 a
55 0 100 a 100 a 100 a 100 a 100 a
Combined 45 0.05 93.3 b 93.3 b 100 a 100 a 100 a
0.1 93.3 b 93.3 b 100 a 100 a 100 a
0.2 93.3 b 100 a 100 a 100 a 100 a
0.4 100 a 100 a 100 a 100 a 100 a
1 100 a 100 a 100 a 100 a 100 a
2 100 a 100 a 100 a 100 a 100 a
50 0.05 93.3 b 100 a 100 a 100 a 100 a
0.1 93.3 b 100 a 100 a 100 a 100 a
0.2 100 a 100 a 100 a 100 a 100 a
0.4 100 a 100 a 100 a 100 a 100 a
1 100 a 100 a 100 a 100 a 100 a
2 100 a 100 a 100 a 100 a 100 a
55 0.05 100 a 100 a 100 a 100 a 100 a
0.1 100 a 100 a 100 a 100 a 100 a
0.2 100 a 100 a 100 a 100 a 100 a
0.4 100 a 100 a 100 a 100 a 100 a
1 100 a 100 a 100 a 100 a 100 a
2 100 a 100 a 100 a 100 a 100 a
Means followed by the same letter within a column are not significantly different at p<0.05 by Duncan’s multiple range tests.

45oC와 50oC 온탕침지 후 pH 교정황토유황합제를 처리하였더니 동일한 처리시간에서 pH 교정황토유황합제 처리가 온탕침지 처리보다 같거나 유의적으로 높은 세균 소독효과를 보였다. 55oC 온탕에서 10분 이상 침지 후 pH 교정황토유황합제를 처리할 경우 모든 농도의 pH 교정황토유황합제 처리에서 100%의 매우 높은 곰팡이 소독효과를 보였다(Table 4).

Gianessi와 Reigner (2005)의 보고에 의하면 유황은 실온에서 부드럽고 밝은 노란색 고체로 가장 오래된 효과적인 살균제로 알려져 있으며 식물체에 투여하면 필름형태로 식물체 표면에 존재하고 식물체로부터 수증기를 방출하게 한다. 또한 흰가루병원균은 균체로부터 수소(H)를 생성하는데 이것이 유황과 반응하면 곰팡이에 독성이 있는 황화수소(H2S)가스를 형성하여 흰가루병을 방제할 수 있다고 한다.

본 연구 결과에서는 무소독 수박종자에서 곰팡이의 살균효과는 온탕침지 단독으로 처리하는 것 보다 pH 교정황토 유황합제를 혼용처리할 경우 살균효과가 증가하는 것으로 조사되었다.

온탕침지와 pH 교정황토유황합제에 의한 수박종자의 입묘율에 미치는 영향

온탕침지와 pH 교정황토유황합제 처리에 따른 수박종자의 입묘율에 미치는 영향을 조사하였더니, 온탕침지조건에서는 단독으로 처리할 경우 45oC에서 20분 또는 25분간 처리할 경우 수박종자의 발아율이 각각 90.3%와 80.0%로 가장 높은 입묘율을 보였다. 그러나 온탕침지 온도가 50oC 또는 55oC일 경우 수박종자의 입묘율이 처리시간의 경과에 따라 급속히 감소하는 것으로 나타났다(Table 5).

Table 5. 
Effect of a single- or combined treatment with loess sulfur mixture and hot water on emergence of organic watermelon seeds under difference treatment time and temperature
Treatment Hot water Temperature (oC) Loess sulfur mixture (%) Disinfection rate of bacteria (%)
10 min. 15 min. 20 min. 25 min. 30 min.
Single 45 0 53.3 b 60.0 b 96.3 a 80.0 a 73.3 a
50 0 83.3 a 90.7 a 76.7 b 60.0 b 56.7 b
55 0 33.0 c 40.0 c 33.0 c 27.0 c 13.0 c
Combined 45 0.05 86.7 a 90.0 a 93.3 a 83.3 a 73.3 a
0.1 86.7 a 85.0 b 93.3 a 83.3 a 66.7 b
0.2 73.3 b 80.0 b 83.3 b 70.0 b 66.7 b
0.4 66.7 c 70.0 c 70.0 c 73.3 b 56.7 c
1 66.7 c 70.0 c 60.0 d 56.7 c 56.7 c
2 56.7 d 66.7 d 53.3 e 46.7 c 40.0 d
50 0.05 80.0 a 93.3 a 76.7 a 73.3 a 60.0 a
0.1 66.7 b 86.7 b 66.7 b 60.0 b 60.0 a
0.2 66.7 b 76.7 c 66.7 b 60.0 b 60.0 a
0.4 60.0 c 63.3 d 66.7 b 60.0 b 56.7 b
1 60.0 c 60.0 d 60.0 c 53.3 c 50.0 c
2 53.3 d 50.0 e 50.0 d 20.0 d 20.0 d
55 0.05 36.0 a 43.3 a 36.7 a 33.3 a 13.0 a
0.1 36.7 a 36.7 b 36.3 a 26.7 b 13.7 a
0.2 36.3 a 36.7 b 26.3 b 20.0 c 13.7 a
0.4 33.7 b 30.3 c 26.7 b 20.0 c 13.0 a
1 28.3 b 27.6 d 13.3 c 10.3 d 10.6 b
2 20.0 d 27.3 d 10.0 c 11.3 d 5.7 c
Means followed by the same letter within a column are not significantly different at p<0.05

온탕침지 후 pH 교정황토유황합제를 처리할 경우 온탕침지 처리 온도와 시간 및 pH 교정황토유황합제의 농도가 증가할수록 수박묘의 입묘율이 급격히 감소하였다. 45oC 온탕에서 20분간 침지 후, pH 교정황토유황합제를 농도별로 처리하였더니 0.05%와 0.1% pH 교정황토유황합제 처리에서 수박유묘의 입묘율이 93.3%로 가장 높게 나타났으나 pH 교정황토유황합제의 농도가 증가할수록 입묘율이 감소하였다. 50oC 온탕에서 15분간 침지 후, pH 교정황토유황합제를 농도별로 처리하였더니 0.05% pH 교정황토유황합제 처리에서 수박 유묘의 입묘율이 93.3%로 가장 높게 나타났으나 pH 교정황토유황합제의 농도가 증가할수록 입묘율이 감소하였다. 55oC 온탕에서 침지 후, pH 교정황토유황합제를 농도별로 처리하였더니 모든 농도의 pH 교정황토유황합제 처리에서 수박 유묘의 입묘율이 43.3% 이하로 나타났으며 pH 교정황토유황합제의 농도가 증가함에 따라 동일한 온탕침지 조건에서보다 수박 유묘의 입묘율이 급격히 감소하는 경향을 보였다(Table 5).

Miller와 Ivey (2004)는 스쿼시, 호박 수박 등의 박과류는 온탕침지에 민감하기 때문에 온탕침지 종자소독이 적합하지 않다고 보고한 바 있다. 국내에서는 Lee 등(2007)의 보고에 의하면 호박 종자는 50oC 온탕에서 15분간, 오이는 50oC 온탕에서 25분간 처리하는 것이 좋다고 보고하였으나 오이의 발아율은 97.3%인 반면 호박의 발아율은 42.7%로 박과류 종자는 온탕침지 온도와 시간에 영향을 많이 받는 것으로 생각된다. 본 연구결과에서도 온탕침지 온도와 시간의 증가가 수박종자의 소독효과를 높이기도 하지만 입묘율을 낮추는 원인이 되는 것으로 나타나 적정한 온도와 처리시간의 선택이 중요할 것으로 생각한다.

이상의 결과를 미루어볼 때 온탕침지 단독처리 보다는 pH교정황토유황합제를 혼용 처리하는 것이 수박종자에 감염된 곰팡이나 세균의 살균효과를 유의적으로 상승하는데 도움이 되는 것으로 생각한다.


Acknowledgments

본 연구는 농촌진흥청 국립농업과학원 농업과학기술 연구 개발사업(과제번호:PJ01248002)의 지원에 의해 이루어진 것입니다.


References
1. Ahn, I., (2010), Setting of evaluation criteria for safety management of organic farming materials in the major OECD nations, Rural Development Administration (RDA) Annual Report, Korea.
2. Barnett, H. L., and B. B. Hunter, (1998), Illustrated genera of imperfect fungi, 4th APS Press, USA, p218.
3. Choi, B. H., B. H. Hong, G. Y. Kang, J. K. Kim, S. H. Kim, and T. K. Min, (2001), Shingo Seed Sciences, Hyangmun Co. Ltd, Korea, p314.
4. Emily, G., (2016), Organic seed treatments and coatings. eXtension, https://articles.extension.org/pages/18952/organic-seed-treatments-and-coatings Accessed 10 September 2018.
5. Gabrielson, R. L., (1983), Blackleg diseases of crucifers caused by Leptosphaeria maculans (Phoma lingam) and its control, Seed Sci. Technol, 11, p749-780.
6. Gianessi, L. P., and N. Reigner, (2005), The value of fungicides in U.S. crop production, Crop Life Foundation, Washington, DC, http://www.croplifefoundation.org/upload/137%20CropLife%20Foundation%20Fungicide%20Benefits.pdf (Accessed 10 Septembe 2018).
7. Gitaitis, R., and R. Walcott, (2007), The epidemiology and management of seedborne bacterial diseases, Annu. Rev. Phytopathol, 45, p371-397.
8. Glass, N. L., and G. C. Donaldson, (1995), Development of primer sets designed for use with the PCR to amplify conserved genes from filamentous ascomycetes, Appl. Environ. Microbiol, 61(4), p1323-1330.
9. Hermansen, A., G. Brodal, and G. Balvoll, (2000), Hot water treatment of carrot seeds: effects on seed-borne fungi, germination, emergence, and yield, Seed Sci. Technol, 27(2), p599-613.
10. Jensen, J. L., (1988), The propagation and prevention of smut in oats and barley, J. Royal Agric. Soci. Engl. Sec, 2(24), p397-415.
11. Kasselaki, A. M., N. E. Malathrakis, D. E. Goumas, J. M. Cooper, and C. Leifert, (2008), Effect of alternative treatments on seed-borne Didymella lycopersici in tomato, J. Appl. Microbiol, 105(1), p36-41.
12. Lee, J. H., S. S. Shen, Y. J. Park, K. Y. Ryu, and H. J. Jee, (2007), Evaluation of hot water treatment for disinfection of vegetable seeds for organic farming, Res. Plant Dis, 13(3), p157-163.
13. Manceau, C., and A. Horvais, (1997), Assessment of genetic diversity among strains of Pseudomonas syringae by PCR-restriction fragment length polymorphism analysis of rRNA operons with special emphasis on P. syringae pv. tomato, Appl Environ Microbiol, 63(2), p498-505.
14. Miller, S. A., L. Melanie, and I. Lewis, (2005), Hot water and chlorine treatment of vegetable seeds to eradicate bacterial plant pathogens, Ohio State University Extension Fact Sheet.
15. Nega, E., R. Ulrich, S. Werner, and M. Jahn, (2003), Hot water treatment of vegetable seed- an alternative seed treatment method to control seed-borne pathogens in organic farming, J. Plant Dis. and Pro, 110(3), p220-234.
16. Noble, M., and M. J. Richardson, (1968), Handbook on seed health testing, series 1(1), Wageningen, Netherlands, The International Seed Testing Association.
17. du Toit, L. J., and P. Hernandez-Perez, (2005), Efficacy of hot water and chlorine for eradication of Cladosporium variabile, Stemphylium botryosum, and Verticillium dahliae from spinach seed, Plant Disease, 89(12), p1309-1312.
18. OMRI (Organic Materials Review Institute), (2012), OMRI Product List, (web edition), (www.omri.org).
19. Paik, M. K., C. K. Shim, J. B. Lee, J. A. Oh, M. H. Jeong, D. H. Kim, M. J. Kim, H. J. Jee, E. J. Choi, and H. J. Cho, (2012), Acute toxicity evaluation of loess-sulfur complex in different pH, J. of Pesticide Sci, 16(4), p369-375.
20. Sung, J. H., H. J. Lee, and H. G. Jung, (2017), Present situation and tasks of domestic and foreign environmental-friendly agricultural products market in 2017, Agri. Policy Focus, 155, KREI, p20.
21. Trapmann, M., and E. E. Drechler, (2000), Die curative Wirkung von Schwefelkalk gegen Apfelschorf, Obstbau, 25(10), p559-561.
22. U.S. Environmental Protection Agency (EPA), (1991), Reregistration Eligibility Document Facts: Sulfur, US EPA, Pesticides and Toxic Substances, (7508W), 738-F-91-110 Washington, DC.
23. Yoo, S. H., W. G. Kim, W. D. Cho, and Y. H. Lee, (1994), Study on the identification of plant pathogens isolated from commercial vegetable seed, National Institute of Agricultural Sciences, Korea, p729-726.