Current Issue

Tobacco cutworm larvae were obtained from the National Institute of Agricultural Sciences, Rural Development Administration (Wanju, JB, Korea), and continuously reared (Kim et al., 2008) at 25^oC ± 2^oC and 50–60% relative humidity in petri dishes (90 X 15, SPL; Pocheon, GG, Korea) under a 16L:8D photoperiod. The larvae were fed artificial feed (Goh et al., 1990).

JH III, pyriproxyfen, fenoxycarb, methoprene, hydroprene, and kinoprene used in this study were purchased from Sigma-Aldrich (St. Louis, MO, USA), and JH I and II were purchased from MuseChem (Fairfield, NJ, USA). A total of 1,628 plant extracts including gladiolus extracted with methanol at a concentration of 20 mg/mL were obtained from the Plant Extract Bank of Korea (Daejeon, Korea) for use in our experiments. In addition, methyl linderone was used as a positive control, which was separated and stored as in a previous study (Lee et al., 2015).

Approximately 99 million (101 bases) reads were generated for S. litura using Illumina RNA sequencing, and de novo assembly was performed using Trinity (Grabherr et al., 2011). Met and Taiman of Drosophila melanogaster were registered in GenBank as query sequences using TBLASTN after confirming the encoding cDNA sequences of Met and SRC.

Full-length cDNA encoding the Met open reading frame (ORF) (i.e., M1-L527 [Genbank ID: MW759040]) and partial cDNA encoding the SRC ORF (i.e., M1-P577 [Genbank ID: MW759041]) for tobacco cutworm were introduced into yeast two-hybrid bait and prey plasmids, respectively. The bait plasmid was prepared by cloning Met cDNA into the GAL4 DNA-binding domain of the pGBKT7 vector (Clontech, Mountain View, CA, USA), and the prey plasmid was prepared by cloning the GAL4-AD fusion plasmid (Clontech) of the pGADT7 vector containing SRC.

S. litura Met forward: 5’CGTACATATGACATCTTCAGGTGGACCAAG3’

S. litura Met reverse: 5’CGTAGAATTCTTACAGATCTACTTCATTAAC3’

S. litura SRC forward: 5’CGTACATATGGTACAAACAGAACCTGTGC3’

S. litura SRC reverse: 5’CGTAGAATTCGGGCGTGTGCGGCGTGTG3’

Both Met bait and SRC prey plasmids were transformed into yeast Y187 cells, and the transformed Y187 cells were incubated at 30^oC in SD-Leu/−Trp double dropout medium until the OD₆₀₀ reached 0.3–0.4. The cells were then centrifuged and suspended in a double volume of culture media. The cells were further incubated for 3 h, and 100 μL of each was dispensed in a 96-well plate (OD₆₀₀ = 0.2–0.3). Both JH and JH analog (JHA) at concentrations of 0, 0.01, 0.1, 1, and 10 ppm were applied to the cells and incubated for an additional 3 h. β-Galactosidase activity was analyzed using a β-galactosidase assay kit (Thermo Scientific, Waltham, MA, USA). In addition, OD₄₂₀ was measured after the assay reaction mixtures were incubated at 25^oC for 12 h.

The transformant comprising Met and SRC of tobacco cutworm was incubated in SD-Leu/−Trp double dropout medium at 30^oC until the OD₆₀₀ reached 0.3–0.4. The cells were then centrifuged and suspended in a double volume of culture media, followed by an additional 3 h incubation. After 0.1 ppm of juvenile hormone was dispensed into the wells of a 96-well plate containing 100 μL of the culture, 200 ppm of each of the 1,628 plant extracts including gladiolus extracts was applied. In addition, 10 ppm of methyl linderone was used as a positive control, and DMSO, which is a vehicle used to dissolve plant extracts, was used as a negative control. Each plate treated with plant extracts was further incubated at 30^oC for 5 h. After the incubation, each plate was treated with a reagent from a β-galactosidase assay kit (Thermo Scientific), and β-galactosidase activity was compared and analyzed by measuring the OD₄₂₀. Normalization was performed using the measured values. For normalization, the specific JHD activity of each plant extract was calculated using the following equation:

Artificial feed was prepared by adding red pepper leaf and 20 mg/mL of methanol extract of gladiolus at 10% of the weight of the artificial feed. Ten tobacco cutworm larvae at 1~3 instar stages were placed in each petri dish, and the development status of each was compared by measuring the weight by instar stage according to the date when supplying artificial feed + red pepper leaf extract 10% (w/w, negative control) and artificial feed + gladiolus extract 10% (w/w, treatment) every 2 days. A group receiving only artificial feed was used as a control group.

Total RNA was extracted using the RNeasy kit (Qiagen, Hilden, Germany) from first instar larvae fed with control, pepper leaf, and gladiolus extract. For RT-qPCR, cDNA was synthesized from 1 μg of total RNA using the iScript cDNA Synthesis kit (BIO-RAD, Hercules, CA, USA). After the concentration of each cDNA was measured using a NanoDrop ND-1000 Spectrophotometer (Thermo Scientific, Middlesex County, MA, USA), the cDNA was diluted and used for qRT-PCR. Primers of target genes (Kr-h1, Hsp83) were designed using primer 3 (https://bioinfo.ut.ee/primer3-0.4.0/). After 20 μL reaction mixtures of the diluted cDNA were prepared using BIO-RAD and SsoAdvanced Universal SYBR Green Supermix (BIO-RAD), RT-qPCR was performed with the following conditions: 35 cycles of 94^oC for 15 s, 60^oC for 20 s, and 72^oC for 15 s. The experiment was repeated thrice.

S. litura Hsp83 forward: AAACTGGCTGACTTGCTCCG

S. litura Hsp83 reverse: AACCACGCTTCTTGACTCGC

S. litura Krüppel homolog 1 forward: GGGACAACTGGTCATCCATC

S. litura Krüppel homolog 1 reverse: ACTGTGCAACGGTAACAACG

S. litura rp49 forward: AAGACCCGTCACATGCTACC

S. litura rp49 reverse: AGAATTGGTGACCCTGATGC

Met and SRC sequences of tobacco cutworm were obtained from larvae through RNA-seq and de novo transcriptome assembly to construct a species-specific JHD analysis system for tobacco cutworm. The cDNA sequence encoding the full length of the ORF of Met was inserted into the yeast two-hybrid bait plasmid, and the cDNA sequence encoding the partial ORF was cloned into the yeast two-hybrid prey plasmid. The specificity of JH and JHA to the Met–SRC receptor complex of tobacco cutworm was confirmed using a tobacco cutworm analysis system. The Met–SRC complex was bound to JH, and the binding was JH- and JHA-dependent, except for methoprene and kinoprene, which acted as JHAs at 0.01 ppm concentration. The highest affinity was obtained with JH III (Fig. 1).

Fig. 1. 
Microplate simulation of juvenile hormone III (JH III)- or juvenile hormone analog (JHA)-dependent methoprene-tolerant (Met)–steroid receptor coactivator (SRC) binding in Spodoptera litura. The JH/JHA-mediated binding of Met and SRC was measured as OD₄₂₀ values after assaying β-galactosidase activity. Values and error bars indicate means ± SD (n = 3).

JHD activity tests were performed using the JHD assay system of tobacco cutworm with 1,628 plant extracts that were extracted with methanol. Based on the results, values ranging from 0.1 or less (without JHD activity) to 1.0 or higher (with high JHD activity) were identified. Based on this, average values of JHD activity of plant groups classified as angiosperms, gymnosperms, and spore-bearing plants were compared to check whether the JHD activity of plant extracts showed differentiation according to the taxa. Gymnosperms showed high average values. However, 20 plant extracts with the highest JHD activity generally belonged to angiosperms (Fig. 2A). In addition, upon comparing the average values by selecting families that included more than 10 plant species, plant families with high mean values of JHD activity were identified as Cupressaceae, Pinaceae, and Araliaceae (Fig. 2C). Among the 20 plant extracts with the highest JHD activity, gladiolus extract showed the highest JHD activity, and extracts from Camellia, Hosta longipes, and Lindera erythrocarpa exhibited high JHD activity by virtue of disrupting the binding of the Met–SRC complex in tobacco cutworm (Fig. 2B).

Fig. 2. 
Distribution of juvenile hormone disruptor (JHD) activity among vascular plants. The JHD activities of 1,628 plant species were screened using Spodoptera litura Met–SRC binding assay systems. A: Mean JHD activities of three major plant groups. B: Mean JHD activities of 20 plant species that exhibited significantly high JHD activity in S. litura. C: Average JHD activity value for each plant family including more than 10 species. Values and error bars indicate means ± SEM; p < 0.0001 (t-test).

To proceed with the bioassay of tobacco cutworm, we confirmed that the growth of larvae was inhibited when gladiolus extract, which showed the highest JHD activity in the JHD assay system, was mixed with artificial feed (Supplementary Figs. 1–3). Although there were differences in b ody w eig hts as t he l arvae g rew in t he c ontrol g roup (artificial feed) and negative control group (red pepper extract 10% + artificial feed), 77.7% and 83.3% of the larvae in each group grew normally, respectively. However, larvae fed artificial feed containing 10% gladiolus extract did not grow normally. Therefore, the larvae of each instar stage compared to the larvae in the control group showed a significant reduction in body weight increase (Fig. 3), and the larvae did not grow properly as pupae, resulting in a 0% rate of adult emergence (Table 1). To investigate the effect of gladiolus extract on the expression of JH-induced genes in tobacco cutworm larvae, qPCR was performed on the gene expression of Krüppel homolog 1 (Kr-h1), known as a JH subgene, and heat shock protein 83 (Hsp83), t he g ene encoding a protein bound to the JH response region in the presence of JH, in larvae fed artificial feed mixed with gladiolus extract. The expression levels of both genes were lower than that in the control group in the case of larvae fed the artificial feed mixed with gladiolus extract (Fig. 4).

Fig. 3. 
Effect of gladiolus extract on the feeding and growth of Spodoptera litura larvae. Effect of gladiolus on weight gain per 10 larvae during a 3-week feeding period. The artificial feed was supplemented with 10% (w/w) gladiolus extract, 10% (w/w) red pepper leaf extract, or ethanol. Weight gain was calculated as the difference between the weight of 10 larvae of each instar. Values and error bars indicate means ± SD (n = 3); p < 0.05 (t-test).

Fig. 4. 
Validation of the juvenile hormone disruptor (JHD) activity gene from Spodoptera litura. JHD-dependent regulation of two genes: Krüppel homolog 1 (Kr-h1) and heat shock protein 83 (Hsp83). Transcript levels were measured by quantitative polymerase chain reaction (qPCR). Values and error bars indicate means ± SD (n = 3); p < 0.05 (t-test).