The Korean Society of Pesticide Science
[ ORIGINAL ARTICLES ]
The Korean Journal of Pesticide Science - Vol. 29, No. 4, pp.309-317
ISSN: 1226-6183 (Print) 2287-2051 (Online)
Print publication date 31 Dec 2025
Received 21 Nov 2025 Revised 03 Dec 2025 Accepted 05 Dec 2025
DOI: https://doi.org/10.7585/kjps.2025.29.4.309

Methyl benzoate의 거짓쌀도둑거저리(Tribolium castaneum)에 대한 발육 저해 영향

유재상1 ; 이원석2 ; 성건묵1, 2, *
1충남대학교 스마트농업시스템학과
2충남대학교 응용생물학과
Evaluating Toxicity Effects of Methyl Benzoate on the Development of Red Flour Beetle, Tribolium castaneum
Jae Sang Yu1 ; Won Seok Lee2 ; Keon Mook Seong1, 2, *
1Department of Smart Agriculture Systems, College of Agriculture and Life Sciences, Chungnam National University, Daejeon 34134, Republic of Korea
2Department of Applied Biology, College of Agriculture and Life Sciences, Chungnam National University, Daejeon 34134, Republic of Korea

Correspondence to: *E-mail: kseong6@cnu.ac.kr

초록

Methyl benzoate (MBe)는 높은 살충 활성과 낮은 환경 잔류성으로 인해 저장해충 방제를 위한 유망한 대체 훈증제로 인식되고 있는 식물 유래 휘발성 화합물이다. 그러나 MBe의 Sublethal 효과와 내분비 조절에 미치는 영향은 여전히 충분히 규명되지 않았다. 본 연구에서는 저장해충인 거짓쌀도둑거저리(Tribolium castaneum)을 대상으로 MBe의 훈증 독성에 따른 발달 지연 및 관련 유전자 발현에 미치는 영향을 평가하였다. 성충과 유충은 MBe에 훈증으로 노출하였으며, Pyriproxyfen은 처리 사료를 통해 적용하였다. 중간 치사량(LD50)은 프로빗 분석으로 추정하였고, Sublethal 효과는 LD20 수준에서 평가하였다. MBe는 발달 단계별 차이를 보이는 독성을 나타내 성충과 유충에서 각각 3.92 μL와 34.40 μL의 LD₅₀ 값을 보였고, Pyriproxyfen은 유충에서만 독성을 나타내며 LD₅₀는 131.74 mg이었다. LD20 수준에서 MBe는 유충의 길이 및 체중 증가를 촉진하였으나 유충 기간을 두 배 이상 연장시키고 과잉 탈피를 유도한 반면, Pyriproxyfen은 성장률을 감소시키고 마찬가지로 발달을 지연시켰다. RT-qPCR 분석 결과, MBe는 Juvenile hormone epoxide hydrolase (JHEH)발현을 감소시키고 Broad-complex (BR-C)를 강하게 상향 조절한 반면, Pyriproxyfen은 Juvenile hormone acid O-methyltransferase (JHAMT)와 JHEH 발현을 감소시키는 동시에 Juvenile hormone esterase (JHE), Kruppel-homolog 1 (Kr-h1) 및 BR-C 발현을 증가시키는 등 상이한 전사 조절 패턴을 보였다. 이러한 결과는 MBe가 T. castaneum에 대해 효과적인 훈증제로 작용할 뿐만 아니라 Pyriproxyfen과는 다른 작용 기전을 통해 Sublethal 농도에서 성장과 내분비 조절을 교란함을 시사하며, 저장해충 방제를 위한 대체 훈증제로서의 잠재력을 뒷받침하고 그 기전에 대한 추가적인 연구 필요성을 강조한다.

Abstract

Methyl benzoate (MBe) is a plant-derived volatile compound used to control insects in store products. It is recognized as a promising, alternate fumigant due to its high insecticidal activity and low environmental persistence. However, its sublethal effects and impact on endocrine regulation in pests are insufficiently characterized. In our study, we investigated the fumigant toxicity of MBe and its effects on the development as well as juvenile hormone–related gene expression of the red flour beetle, Tribolium castaneum, in store products. Adults and larvae of the red flour beetle were exposed to either MBe by fumigation or pyriproxyfen through a treated diet. Median lethal doses (LD50) were estimated by probit analysis, and sublethal effects were assessed at the LD20 level. Methyl benzoate showed development stage-specific toxicity, with LD50 values of 3.92 μL in adults and 34.4 μL in larvae. However, we observed toxic effects of pyriproxyfen only in larvae with a high LD50 value of 131.74 mg. At LD20, MBe increased larval growth in length and weight, more than doubled the larval growth period, and induced supernumerary molts. In contrast, pyriproxyfen reduced larval growth rates and consequently delayed development at LD20. Real-time quantitative PCR (RT-qPCR) analysis revealed distinct gene transcriptional signatures: MBe downregulated the expression of juvenile hormone epoxide hydrolase (JHEH) and strongly upregulated that of Broad-complex (BR-C). Pyriproxyfen downregulated juvenile hormone acid O-methyltransferase (JHAMT) and JHEH but upregulated juvenile hormone esterase (JHE), Kruppel-homolog 1 (Kr-h1), and BR-C. These findings suggest that MBe not only acts as an effective fumigant against T. castaneum but also disrupts growth and endocrine regulation at sublethal doses through a mode of action distinct from pyriproxyfen. Our results support the potential of MBe as an alternate fumigant and underscore the need for further mechanistic studies of action.

Keywords:

Fumigation, methyl benzoate, pyriproxyfen, Tribolium castaneum, red flour beetle

키워드:

거짓쌀도둑거저리, 메틸벤조에이트, 발달 저해, 아치사효과, 훈증

서 론

전 세계적으로 농산물의 수확 후 운송과 저장 과정에서 발견되는 곤충은 1,663종이 보고되었지만, 이 가운데 경제적 피해가 크고 방제가 필요한 종은 134종이다. 특히 주요 해충의 대부분은 딱정벌레목과 나비목에 속한다(Hagstrum and Subramanyam, 2009). 특히 곡물 저장 시설에서 곤충으로 인한 손실은 전 세계적으로 빈번한 문제이며, 그 결과 선진국에서는 5–10%, 개발도상국에서는 35–75%의 식품 손실이 발생한다(Boxall, 2001; Hodges et al., 2011). 저장 시설에서는 저곡 해충 방제를 위해 훈증제 의존도가 높으며, 대표적인 훈증제로는 메틸브로마이드(Methyl bromide)와 포스핀(Phosphine)이 널리 사용되었다. 그러나 메틸브로마이드는 오존층 파괴 물질로 사용이 금지되었고, 포스핀 저항성의 확산으로 인해 대체 훈증제 개발의 필요성이 대두되고 있다(Hagstrum and Phillips, 2017).

자연적으로 존재하는 식물 추출물은 다양한 해충을 방제하기 위한 식물성 살충제로 광범위하게 활용되어 왔다(Kordali et al., 2008; Miresmailli and Isman, 2014). 이들 식물 추출물은 빠른 분해성과 비표적 생물에 대한 낮은 독성으로 인해 사용이 권장되고 있다(Copping and Duke, 2007; Adorjan and Buchbauer, 2010; De Oliveira et al., 2014). 메틸벤조에이트(Methyl benzoate, MBe) 또한 토양 잔류성이 낮고 비표적 생물에 대한 독성이 낮은 특성을 가진다(Zhao et al., 2022). 이 물질은 금어초(Antirrhinum ssp.)(Dudareva et al., 2000), 페튜니아(Petunia ssp.)(Negre et al., 2003)등 식물에서 자연적으로 발견되며, 벼(Oryza sativa)가 초식성 곤충에 의해 손상될 때도 방출된다(Zhao et al., 2010). MBe는 다양한 곤충종에 대해 살충 효과와 아치사 효과(Sublethal effect)가 보고되었으며, 담배가루이(Bemisia tabaci)에서는 살충 효과뿐 아니라 기피 및 산란억제 효과가 확인되었고(Mostafiz et al., 2018), 불개미(Solenopsis invicta)에서는 강력한 훈증효과를 보였다(Chen et al., 2019). 또한 담배거세미나방(Spodoptera frugiperda)의 알, 유충, 성충 단계에서 살충효과를 나타냈으며, 유충에서는 높은 기피 및 섭식 저해, 성충에서는 높은 산란억제 효과가 보고되었다(Zhao et al., 2022). 나아가 MBe는 β-cyfluthrin, sulfur-pyrethrin 혼합물, 유기농 에센셜 오일 혼합물 대비 썩덩나무노린재(Halyomorpha halys), 배추좀나방(Plutella xylostella), Manduca sexta 성충에 대해 약 5–20 배 높은 독성을 나타냈다(Feng and Zhang, 2017).

살충제의 활성을 평가할 때는 전통적으로 치사독성(lethal toxicity)에 중점을 두어 왔으나, 최근에는 아치사(sublethal) 효과까지 함께 평가하는 경향이 변화하고 있다. 상용 합성 살충제에 비해 식물성 살충제는 대체로 급성독성(acute toxicity) 중심의 연구가 이루어져 왔다. 그러나 이러한 식물 유래 제제는 휘발성 또는 빠른 분해 특성으로 인해 아치사 농도로 표적 생물에게 노출될 가능성이 높다. 뿐만 아니라 비표적 생물애게도 노출되어 생리적 변화를 일으킬 수 있다(Turchen et al., 2020). 독성 물질의 아치사 농도 노출은 주요 작용 표적 외에도 부수적(secondary) 표적과 상호작용할 수 있으며, 독성 물질에 의해 유도되는 해독 효소의 발현 증가는 살충제 처리에 대한 저항성 발달의 기반이 될 수 있다. 또한 생존을 우선시 하면서 성장이나 번식 능력을 일부 희생하는 생리적 상충(physiological trade-off)을 유발한다(Guedes et al., 2016).

본 연구에서는 주요 저곡해충 중 하나인 거짓쌀도둑거저리(Tribolium castaneum)에 MBe를 훈증 처리한 결과, 과탈피 현상을 관찰하였다. 우리는 MBe가 이전에 알려진 살충효과 외에 발육 저해 양상을 이해하기 위하여 유약호르몬 생합성과 분해에 관여하는 Juvenile hormone acid O-methyltransferase (JHAMT), Juvenile hormone esterase (JHE), Juvenile hormone expoxide hydrolase (JHEH) 유전자, 그리고 호르몬 신호 전달에 관여하는 Methoprene-tolerant (MET), Kruppel-homolog 1(Kr-h1), Broad-complex (BR-C) 유전자의 발현량을 분석하였다. 이전 연구에서 Itoa orientalis에서 추출한 식물 유래 살충 성분인 Itol A를 S. fugiperda에 처리했을 때, 전사체 수준에서 JHAMT의 발현은 감소하고 JHE와 JHEH의 발현은 증가하여 이 물질이 유약호르몬 대사를 교란한다는 보고가 있었다(Xu et al., 2022). 또한 Tribolium castaneum에 유약호르몬 유사체인 Pyriproxyfen을 처리했을 때 Kr-h1의 발현량이 증가한다는 보고도 있었다(Charles et al., 2011). 그러나 Methyl benzoate에 대해서는 생식과 섭식 저해 효과에 대한 보고는 있었지만, 유약호르몬과 연관된 유전자의 발현량 변화에 대한 연구는 부족하다. 이에 본 연구에서는 Methyl benzoate가 거짓쌀도둑거저리의 발육에 미치는 영향을 평가하고, 대체 훈증물질로서의 가능성을 탐색하였다.


재료 및 방법

거짓쌀도둑거저리 사육

실험에 사용된 거짓쌀도둑거저리는 농림축산검역본부 식물검역기술센터로부터 제공받았다. 해당 곤충은 이스트를 밀가루 대비 10% (w/w) 첨가한 인공사료로 사육했으며, 지름 10 cm의 원형 플라스틱통에 약 1 cm 깊이로 사료를 채운 후, 공기 순환을 위해 망사가 있는 뚜껑을 덮어 사육하였다. 모든 곤충은 25±2oC 온도, 상대습도 60−70% 조건에서 사육되었다.

실험 약제

Methyl benzoate (500 g, 99%, CAS No. 93-58-3)는 Sigma Aldrich(St. Louis, Mo, USA)에서 구입하였다. 양성 대조군으로 사용된 Pyriproxyfen (25 g, >98%, CAS number: 95737-68-1)은 TCI(Tokyo Chemical Industry Co., Ltd., Tokyo, Japan)에서 구입하였다.

약제 생물검정

MBe와 Pyriproxyfen의 독성을 비교하기 위하여 생물검정을 수행하여 반수치사량(Median lethal dose, LD50)을 산출하였다. MBe 처리는 직경 5 cm의 페트리디쉬 리드 내부면에 동일 크기의 필터페이퍼를 부착한 뒤, 해당 필터페이퍼에 MBe를 점적하여 노출시켰다. 대조군은 증류수(DW)를 점적하였다. 반면 Pyriproxyfen은 제형 특성상 훈증 처리에 적합하지 않아, 경구 처리로 평가하였다. 이를 위해 직경 5 cm의 페트리디쉬에 1 g의 인공사료와 Pyriproxyfen을 균일하게 혼합하여 처리하였다. 모든 처리군은 3회 반복으로 수행하였고, 반복 당 거짓쌀도둑거저리 20마리를 사용하여 3령 유충과 성충의 독성을 평가하였다. 처리 후, 모든 페트리디쉬는 25±2oC, 상대습도 60−70%의 곤충 사육실 조건에서 보관하였다. 최종 사충률은 MBe는 처리 72h, Pyriproxyfen은 처리 120h에 확인하였다.

약제 처리에 따른 발육 양상 분석

약제 처리에 따른 발육 양상을 확인하기 위해, 번데기 형성 시점까지 유충의 체중과 길이를 주기적으로 측정하였다. 실험에는 산란 후 3일이 지난 1령 유충을 사용하였으며, 처리군별로 100마리의 유충을 사용하였다. 실험은 100×40 mm 크기의 곤충 사육용기에 인공사료 10 g을 넣어 수행하였다. MBe 처리는 페트리디쉬 리드에 직경 100 mm 필터페이퍼를 부착한 뒤 LD20값(14.5 μL)에 해당되는 용량을 점적하여 노출시켰다. 양성 대조군인 Pyriproxyfen은 LD20값(94.94 mg)을 사료에 균일하게 혼합하여 노출시켰다. 두 약제 모두 농도가 아닌 용량 기준으로 처리하였으며, 처리 용기 부피를 고려해 노출 조건을 동일 하게 유지하였다. 약제 처리는 7일 간격으로 반복하였다. 유충은 디지털 실체현미경(TAESHIN BIO SCIENCE, Korea)으로 촬영한후 Image J 프로그램을 이용하여 길이를 측정하였고, 체중은 전자저울(OHAUS, USA)로 측정하였다. 측정은 무작위로 추출한 10마리를 대상으로 2−3일 간격으로 번데기 형성 시점까지 수행하였다. 모든 실험은 3회 반복으로 수행하였다.

Total RNA 추출

거짓쌀도둑거저리 6령 유충 25마리씩을 페트리디쉬(60 × 15 mm)에 인공사료 1 g을 넣고 실험을 진행하였다. 아무 처리도 하지 않은 개체군을 대조군으로 사용하였다. 약제 처리는 다음과 같이 수행하였다. MBe는 LD20값(1.959 μL)을 필터페이퍼 위에 점적 처리하였고, Pyriproxyfen은 LD20값(9.494 mg)을 인공사료에 혼합하여 처리하였다. 처리 후 24시간 및 48시간이 경과했을 때, 각 시간 지점마다 3마리씩 무작위로 선별하여 전체 개체 조직을 사용해 total RNA를 추출하였다. RNA는 SmartGene Total RNA Extraction Kit(SmartGene, Korea)를 사용하여 추출하였다. 모든 실험은 3회 반복으로 수행하였다. DNA 오염을 제거하기 위하여 DNase I(smartgene, Korea) 처리 과정을 거쳤으며, 추출된 RNA의 농도와 순도는 NanoPhotometer® NP80 분광광도계(IMPLEN, Germany)를 사용하여 확인하였다.

Reverse transcription-quantitative PCR (RT-qPCR) 분석

MBe 노출에 따른 성장 관련 유전자의 전사수준을 확인하기 위해, 유약호르몬(JH) 관련 6개 유전자에 대해 RT-qPCR을 수행하였다. cDNA합성은 oligo(dT) 프라이머와 PrimeScriptTM 1st strand cDNA Synthesis Kit(Takara, Japan)를 사용하여 제조사 지침에 따라 수행하였다. RT-qPCR은 LightCycler 96(Roche) 시스템과 Smartgene Sybr Green Q-PCR Master Mix with Low Rox를 사용하였다. 사용한 프라이머 서열은 Table 1에 제시하였다. PCR 산물의 특이성과 단일성은 멜팅 커브 분석(melting curve analysis)으로 확인하였다. 모든 반응은 생물학적 반복 3회와 기술적 반복 3회로 수행하였다. 리보솜 단백질 S18 유전자(RPS18)을 참조 유전자(reference gene)로 사용하여 각 타겟 유전자의 발현을 정규화 하였다(Liu JinBo et al., 2014). 상대적인 발현 수준은 대조군 대비 2−ΔΔCt 방법을 이용하여 계산하였다(Livak and Schmittgen, 2001).

Primer sequences used in this study for RT-qPCR analyses

통계분석

모든 통계분석은 IBM SPSS Statistics 26.0 (IBM Corp., Armonk, NY, USA)을 사용하여 수행하였다. LD50 및 95% 신뢰구간(95% CI)은 프로빗 회귀분석을 통해 산출하였다. 성장 패턴 분석에서는 유충의 평균 길이(mm) 및 체중(mg)을 시간 경과에 따라 측정하였고, 처리군(treatment)과 시간(time) 및 상호작용 효과를 평가하기 위하여 이원화분산분석(two-way ANOVA)을 실시하였다. 또한 성장패턴의 차이를 검정하기 위하여 선형 회귀분석을 수행하였으며, X축은 사육 일수, Y축은 평균 길이 또는 평균 체중으로 설정하였다. 처리군 간 회귀 기울기(β)와 결정계수(R2)를 비교하여 성장 속도의 차이를 평가하였다. 유전자 발현량의 차이는 각 시간 지점에서 일원분산분석(one-way ANOVA)을 적용하여 처리군간 비교를 수행하였고, 유의미한 차이가 있을 경우 Tukey’s HSD 사후검정을 실시하였다. 모든 분석에서 통계적 유의수준은 α = 0.05(P < 0.05)로 설정하였다.


결 과

거짓쌀도둑거저리에 대한 MBe의 독성

거짓쌀도둑거저리의 유충 및 성충에 MBe와 Pyriproxyfen을 처리한 후, LD50 값을 계산하였다(Table 2). 거짓쌀도둑거저리 성충에서 MBe의 LD50 값은 3.92 μl (95% CI: 3.00−4.89)이고, 유충에서 MBe의 LD50 값은 34.4 μl (95% CI: 21.73−53.53 μl)로 나타났다. 발육 단계에 따라 MBe에 대한 독성이 상이하였으며, 성충에서 유충보다 약 8.7배 높은 독성을 보였다. 대조약제인 Pyriproxyfen은 거짓쌀도둑거저리의 유충에서만 독성을 나타냈다. 유충의 LD50값은 131.74 mg (95% CI: 84.84−214.02 mg)으로 나타났다.

Toxic effects of methyl benzoate and pyriproxyfen on Tribolium castaneum larvae and adults

약제 처리 후 거짓쌀도둑거저리 발육 양상 변화

MBe가 거짓쌀도둑거저리 발육 양상에 미치는 영향을 분석하기 위해 발육 양상을 확인하는 생물검정을 수행하였다(Fig. 1A, B). 유충의 길이와 체중에 대한 이원분산분석(two-way ANOVA) 결과, 길이와 체중 모두 대조군, MBe처리군, Pyriproxyfen처리군 간 유의미한 차이가 있었다. 처리군에 따른 유충의 길이는 유의하게 달랐으며 (F(2,125) = 35.78, P< 0.001), 효과 크기는 η2 = 0.364로 전체 변동의 36.4%가 처리 후 효과로 설명되었다. 처리군에 따른 유충의 체중은 유의하게 달랐으며 (F(2,89) = 35.91, P < 0.001), 효과 크기는 η2 = 0.447로 전체 변동의 44.7%가 처리 후 효과로 설명되었다. 그 후 각 처리군내 발육 양상을 선형 회귀분석을 통하여 단순화하여 변화량을 확인하였다(Fig. 1C, D). 선형회귀 분석 결과 대조군에서 길이 성장의 기울기는 0.13 (R2 = 0.92, p< 0.001)이였고 체중 성장의 기울기는 0.09 (R2 = 0.96, p< 0.001) 였다. MBe 처리군의 성장 속도는 대조군 대비 길이 +12.1% (B = 0.14, R2 = 0.95, P < 0.001), 체중 +31.9%(B = 0.12, R2 = 0.96, P < 0.001)로 유의하게 빨랐다. 반면 pyriproxyfen은 대조군 대비 길이 -9.8%(B = 0.11, R2 = 0.95, P < 0.001), 체중 -12.8%(B = 0.08, R2 = 0.96, P < 0.001)로 성장 속도가 가장 느렸다(Fig. 1C, D). 유충 기간은 대조군 38 ± 4.8일에 비해 MBe 처리군 76.3 ± 14.7일, Pyriproxyfen 처리군 58.2 ± 5.9일로 지연되었다(Fig. 2A). 대조군에서는 38일 경과 후 절반이 6령에서 번데기로 용화 하였으나, MBe와 Pyriproxyfen 처리군에서는 최대 7령까지 성장한 후 용화하지 못하고 폐사하였다(Fig. 2B).

Fig. 1.

Effects of methyl benzoate and pyriproxyfen on the larval growth of T. castaneum. (A) Average body length (mm) of larvae over time. (B) Average body weight (mg) of larvae over time. (C) Linear regression of body length (mm) by days after treatment. (D) Linear regression of body weight (mg) by days after treatment. Colored lines in (C) and (D) represent the regression models fitted to each treatment group (Control, Methyl benzoate, Pyriproxyfen). Slope (B) and R² values are reported in the main text. Each dot represents the mean value at a given time point from repeated experiments.

Fig. 2.

Effects of treatments (Methyl benzoate and Pyriproxyfen) on larval period and survival. The control group was untreated, and all individuals were monitored until pupation, whereas in the treated groups observations continued until the insects failed to pupate and died. (A) Larval period (days) by treatment. Boxes show the interquartile range (IQR), the red line indicates the median, and points represent individual observations. (B) Kaplan–Meier larval survival curves for Control (blue), Pyriproxyfen (green), and Methyl benzoate (red). Overall log-rank test: χ²(2) = 507.2, P < 0.001. Sample sizes: Control n = 300, Methyl benzoate n = 300, Pyriproxyfen n = 300.

약제처리 후 유약호르몬 경로 관련 유전자 발현량 차이

유약호르몬 경로에서 유약호르몬 합성과 분해경로에 관련되어 있는 유전자 JHAMT, JHE, JHEH, BR-C, Kr-h1, MET를 선정하여 시간에 따른 유전자 발현량 변화를 RT-qPCR로 분석하였다(Fig. 3). JHAMT 유전자는 24시간 시점에서 Pyriproxyfen 처리군이 3.3배 감소된 발현 수준을 보였으며, 48시간 시점에서는 세 처리군간 유의미한 변화가 관찰되지 않았다(Fig. 3A). JHE 유전자는 24시간과 48시간에서 Pyriproxyfen 처리군이 각각 3.23배, 9.55배 증가하였다(Fig. 3B). JHEH 유전자는 24시간에서 MBe, Pyriproxyfen 처리군이 각각 1.55배, 2.35배 감소하였다. 48시간에서는 유의미한 차이를 보이지 않았다(Fig. 3C). BR-C 유전자는 24시간에서 Pyriproxyfen 처리군이 5.63배 감소하였고, 48시간에서 MBe, Pyriproxyfen 처리군이 각각 12.75배, 9.47배 증가하였다(Fig. 3D). Kr-h1유전자는 24시간과 48시간에서 Pyriproxyfen 처리군이 각각 19.86배, 28.35배 증가하였다(Fig. 3E). MET 유전자는 통계적으로 유의미하지 않았지만 24시간에서 MBe, Pyriproxyfen처리군이 각각 1.25배 증가, 2.59배 감소하였다(Fig. 3F). 요약하면, MBe는 24시간 시점에서 JHEH 유전자의 발현을 감소시키고, 48시간 시점에서 BR-C 유전자의 발현을 증가시켰다. Pyriproxyfen은 24시간 시점에서 JHAMT와 JHEH 유전자의 발현을 감소시킨 반면, JHE와 Kr-h1 유전자는 전 시점에서 발현이 증가하였고, BR-C 유전자는 48시간 시점에서 발현이 증가하였다. 이러한 결과는 MBe가 양성 대조군인 Pyriproxyfen과 다른 방식으로 성장 관련 유전자의 발현을 교란하거나 방해할 수 있음을 시사한다.

Fig. 3.

Relative expression levels of juvenile hormone- and ecdysone-related genes in T. castaneum larvae after treatment with methyl benzoate and pyriproxyfen. Gene expression was measured at 24 h and 48 h after treatment using RT-qPCR and is shown as 2–ΔΔCt values. (A) JHAMT; (B) JHE; (C) JHEH; (D) BR-C; (E) Kr-h1; (F) MET. Different letters indicate statistically significant differences between groups at each time point (p < 0.05, Tukey’s HSD test). Error bars represent standard error of the mean (SEM).


고 찰

MBe는 담배가루이(Bemisia tabaci), 불개미(Solenopsis invicta), 담배거세미나방(Spodoptera frugiperda), 배추좀나방(Plutella xylostella)등 다양한 곤충에 대해 살충 효과를 나타낸다고 보고되어 있다(Feng and Zhang, 2017; Chen et al., 2019; Zhao et al., 2022; Mostafiz et al., 2018). 본 연구에서도 MBe는 거짓쌀도둑거저리에 대해 훈증 독성을 보였다. 이러한 살충 효과에도 불구하고, MBe의 작용기작에 대해서는 신중한 접근이 필요하다. 실제로 벤조에이트 유도체들도 다양한 곤충에서 살충 활성을 보이는 것으로 알려져 있다(Mostafiz et al., 2019; Larson et al., 2020; Kamel et al., 2024). 예를 들어, Benzyl alcohol은 거짓쌀도둑거저리에 처리 시 acetylcholinesterase (AChE)의 활성을 유의미하게 억제하였으며(Aboelhadid et al., 2023), Benzyl benzoate는 Acanthoscelides obtectus에 처리 시 AChE의 활성을 억제하였다(Abdel-Baki et al., 2024). MBe도 Aphis gossypii, Musca domestica, A. obtectus에서 AChE의 활성을 억제하는 것으로 보고되었다(Kamel et al., 2024; Abdel-Baki et al., 2024; Mostafiz et al., 2020). 특히 M. domestica의 유충에 벤조에이트 유사체를 처리하였을 때 머리부위의 가시와 기문 등에 심한 변형이 발생하였으며, 이는 호흡기 질식을 유발할 수 있는 구조적 변화로 해석된다(Kamel et al., 2024). 또한 MBe는 산화 라디칼 축적을 유도하여 지질 과산화 수준을 증가시키고, 환원형 글루타티온(GSH) 수준을 감소 시키는 등 산화적 스트레스를 유발하는 것으로 보고되었다(Abdel-Baki et al., 2024). 이처럼 벤조에이트 유도체 들은 AChE 억제, 대사 장애 유도, 물리적 손상 등 다양한 작용점을 통해 살충 활성을 나타낼 수 있다(Mostafiz et al., 2022a).

본 연구에서는 MBe 훈증 처리 후 거짓쌀도둑거저리 유충의 발달 기간이 유의하게 길어졌으며, 대부분의 개체가 번데기 단계로 용화하지 못하였다. 이러한 결과는 A. gossypii에서 약충 기간이 유의미하게 지연되었고(Mostafiz et al., 2020), Culex pipiens에서 저농도 노출 시 10%의 개체가 번데기가 되지 못했던 기존 연구와 일부 일치한다(Mostafiz et al., 2022b). 그러나 본 연구에서는 Pyriproxyfen 처리군보다 MBe 처리군에서 유충의 성장 속도가 더 빨라졌으며, 6령 이후까지 탈피가 지속되는 과탈피 현상도 관찰되었다. Bartiling et al.(2024)의 연구에 따르면, 살충제를 아치사농도로 처리하였을 때 곤충의 성장 속도가 가속되거나 지연될 수 있다고 보고된 바가 있다. 이러한 점을 바탕으로 우리는 MBe가 성장과 관련된 유약호르몬(juvenile hormone) 경로를 교란할 수 있을 것이라는 가능성을 제기하였다. 이에 따라 유약 호르몬의 생합성과 분해에 관여하는 JHAMT, JHE, JHEH 유전자, 그리고 호르몬 신호 전달에 관여하는 MET, Kr-h1, BR-C 유전자 발현량을 분석하였다. 그 결과, MBe는 양성 대조군인 Pyriproxyfen과는 다른 방식으로 유전자 발현을 교란하는 것으로 보인다. 유약호르몬 생합성 및 분해 관련 유전자(JHAMT, JHE, JHEH)의 발현은 Pyriproxyfen과 달리 큰 변화가 없었으며, 특히 호르몬 신호 전달과 관련된 BR-C 유전자의 과발현이 두드러졌다. BR-C는 엑다이손 및 유약 호르몬 신호에 의해 발현이 조절되는 유전자로, 탈피 및 변태 조절에 중요한 역할을 한다. 유약호르몬은 알라타체에서 합성 및 분비되며, 알라토트로핀과 알라토스타틴과 같은 신경 펩타이드, 다양한 생리적 자극에 의해 조절된다. 한편, 엑다이손 합성을 유도하는 PTTH는 뇌의 신경분비세포에서 분비되어 전흉샘을 자극한다. Drosophila melanogaster에서 아세틸콜린 처리시, PTTH 뉴런에서 니코틴성 아세틸콜린 수용체를 통해 농도 의존적인 Ca+2증가가 유도되었고, 이는 PTTH 분비를 촉진하는 것으로 보고 되었다(Hao et al., 2021). 따라서 MBe가 AChE 활성을 억제함으로써 아세틸콜린 농도가 증가하고, PTTH 뉴런의 과탈분극을 유도하여 PTTH 과분비, 나아가 BR-C의 과발현까지 연쇄적으로 이어질 수 있다는 가설을 제시할 수 있다. 그러나 이 가설은 아직 실험적 증거가 부족하며, 후속 연구를 통해 명확히 규명되어야 할 것이다.

요약하자면, 본 연구에서는 거짓쌀도둑거저리에 대한 MBe의 훈증 독성을 평가하였으며, 아치사 농도에서 곤충의 성장을 교란시킬 수 있음을 확인하였다. 또한, 성장 관련 유전자의 발현 변화를 통해 MBe가 pyriproxyfen과는 다른 작용 기전을 통해 발달을 방해한다는 가능성을 제시하였다. 향후 연구에서는 MBe가 곤충의 성장 및 내분비계에 미치는 영향을 보다 정밀하게 분석할 필요가 있다.

Acknowledgments

본 연구는 농립축산검역본부 식물검역검사기술개발(과제번호: Z-1543086-2023-25-02)에 의해 수행한 “저곡해충에 대한 신규 훈증물질 활용 및 포스핀 저항성 진단 바이오마커 개발” 과제로 수행되었습니다.

이해상충관계

저자는 이해상충관계가 없음을 선언합니다.

REFERENCES

  • Abdel-Baki A-aS., Ibrahium SM, Aboelhadid SM, Hassan AO, Al-Quraishy S, et al., 2024. Benzyl alcohol, benzyl benzoate and methyl benzoate as bio-insecticides against dried bean beetle Acanthoscelides obtectus (Coleoptera: Tenebrionidae). J. Stored Prod. Res. [https://doi.org/10.1016/j.jspr.2024.102246]
  • Aboelhadid SM, Ibrahium SM, Abdel-Tawab H, Hassan AO, Al-Quraishy S, et al., 2023. Toxicity and repellency efficacy of benzyl alcohol and benzyl benzoate as eco-friendly choices to control the red flour beetle Tribolium castaneum (Herbst. 1797). Molecules. 28(23):7731. [https://doi.org/10.3390/molecules28237731]
  • Adorjan B, Buchbauer G, 2010. Biological properties of essential oils: an updated review. Flavour Frag. J. 25(6):407-426. [https://doi.org/10.1002/ffj.2024]
  • Boxall R, 2001. Post-harvest losses to insects—a world overview. Int. Biodeterior. Biodegrad. 48(1-4):137-152. [https://doi.org/10.1016/S0964-8305(01)00076-2]
  • Charles J-P, Iwema T, Epa V C, Takaki K, Rynes J, et al., 2011. Ligand-binding properties of a juvenile hormone receptor, Methoprene-tolerant. Dev. Biol. 108(52):21128-21133. [https://doi.org/10.1073/pnas.1116123109]
  • Chen J, Rashid T, Feng G, Feng Y, Zhang A, et al., 2019. Insecticidal activity of methyl benzoate analogs against red imported fire ants, Solenopsis invicta (Hymenoptera: Formicidae). J. Econ. Entomol. 112(2):691-698. [https://doi.org/10.1093/jee/toy360]
  • Copping LG, Duke SO, 2007. Natural products that have been used commercially as crop protection agents. Pest Manag. Sci. 63(6):524-554. [https://doi.org/10.1002/ps.1378]
  • De Oliveira JL, Campos EVR, Bakshi M, Abhilash P, Fraceto LF, 2014. Application of nanotechnology for the encapsulation of botanical insecticides for sustainable agriculture: prospects and promises. Biotechnol. Adv. 32(8):1550-1561. [https://doi.org/10.1016/j.biotechadv.2014.10.010]
  • Dudareva N, Murfitt LM, Mann CJ, Gorenstein N, Kolosova N, et al., 2000. Developmental regulation of methyl benzoate biosynthesis and emission in snapdragon flowers. Plant Cell. 12(6):949-961. [https://doi.org/10.1105/tpc.12.6.949]
  • Feng Y, Zhang A, 2017. A floral fragrance, methyl benzoate, is an efficient green pesticide. Sci Rep. 7(1):42168. [https://doi.org/10.1038/srep42168]
  • Hagstrum D, Subramanyam B, 2009. Stored-product insect resource, Elsevier.
  • Hagstrum DW, Phillips TW, 2017. Evolution of stored-product entomology: protecting the world food supply. Annu. Rev. Entomol. 62(1):379-397. [https://doi.org/10.1146/annurev-ento-031616-035146]
  • Hao S, Gestrich JY, Zhang X, Xu M, Wang X, et al., 2021. Neurotransmitters affect larval development by regulating the activity of prothoracicotropic hormone-releasing neurons in Drosophila melanogaster. Front. Neurosci. [https://doi.org/10.3389/fnins.2021.653858]
  • Hodges RJ, Buzby JC, Bennett B, 2011. Postharvest losses and waste in developed and less developed countries: opportunities to improve resource use. J. Agric. Sci. 149(S1):37-45. [https://doi.org/10.1017/S0021859610000936]
  • Kamel AA, Aboelhadid SM, Abdel-Baki A-aS, Ibrahium SM, Al-Quraishy S, et al., 2024. Benzoate derivatives toxicity to Musca domestica results in severe muscle relaxation and body distortion. Neotrop. Entomol. 53(4):972-983. [https://doi.org/10.1007/s13744-024-01154-5]
  • Kordali S, Cakir A, Ozer H, Cakmakci R, Kesdek M, et al., 2008. Antifungal, phytotoxic and insecticidal properties of essential oil isolated from Turkish Origanum acutidens and its three components, carvacrol, thymol and p-cymene. Bioresour. Technol. 99(18):8788-8795. [https://doi.org/10.1016/j.biortech.2008.04.048]
  • Larson NR, Zhang A, Feldlaufer MF, 2020. Fumigation activities of methyl benzoate and its derivatives against the common bed bug (Hemiptera: Cimicidae). J. Econ. Entomol. 57(1):187-191. [https://doi.org/10.1093/jme/tjz138]
  • Liu Jinbo LJ, Ou Jing OJ, Yao Fujiao YF, He Lei HL, Xi Gengsi XG, et al., 2014. Identification of appropriate reference genes for gene expression studies by quantitative real-time PCR in Tribolium castaneum after exposure to phosphine. J. Agr Bio. 22(2):257-264
  • Livak KJ, Schmittgen TD, 2001. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods. 25(4):402-408. [https://doi.org/10.1006/meth.2001.1262]
  • Miresmailli S, Isman MB, 2014. Botanical insecticides inspired by plant–herbivore chemical interactions. Trends Plant Sci. 19(1):29-35. [https://doi.org/10.1016/j.tplants.2013.10.002]
  • Mostafiz MM, Jhan PK, Shim J-K, Lee K-Y, 2018. Methyl benzoate exhibits insecticidal and repellent activities against Bemisia tabaci (Gennadius)(Hemiptera: Aleyrodidae). PLoS One. [https://doi.org/10.1371/journal.pone.0208552]
  • Mostafiz MM, Hassan E, Shim J-K, Lee K-Y, 2019. Insecticidal efficacy of three benzoate derivatives against Aphis gossypii and its predator Chrysoperla carnea. Ecotox. Environ. Safe. [https://doi.org/10.1016/j.ecoenv.2019.109653]
  • Mostafiz MM, Alam MB, Chi H, Hassan E, Shim J-K, et al., 2020. Effects of sublethal doses of methyl benzoate on the life history traits and acetylcholinesterase (AChE) activity of Aphis gossypii. Agronomy-Basel. 10(9):1313. [https://doi.org/10.3390/agronomy10091313]
  • Mostafiz MM, Hassan E, Lee K-Y, 2022a. Methyl benzoate as a promising, environmentally safe insecticide: current status and future perspectives. Agriculture-Basel. 12(3):378. [https://doi.org/10.3390/agriculture12030378]
  • Mostafiz MM, Ryu J, Akintola AA, Choi KS, Hwang U Wet al., 2022b. Larvicidal activity of methyl benzoate, a volatile organic compound, against the mosquitoes Aedes albopictus and Culex pipiens (Diptera: Culicidae). J. Med. Entomol. 59(2):788-794. [https://doi.org/10.1093/jme/tjab230]
  • Negre F, Kish CM, Boatright J, Underwood B, Shibuya K, et al., 2003. Regulation of methylbenzoate emission after pollination in snapdragon and petunia flowers. Plant Cell. 15(12):2992-3006. [https://doi.org/10.1105/tpc.016766]
  • Xu L, Meng XL, Bangash SH, Zhang F, Zeng DQ, et al., 2022. Effects of itol A on the larval growth and development of Spodoptera frugiperda (Lepidoptera: Noctuidae). Pest Manag. Sci. 78(1):134-142. [https://doi.org/10.1002/ps.6614]
  • Zhao N, Guan J, Ferrer J-L, Engle N, Chern M, et al., 2010. Biosynthesis and emission of insect-induced methyl salicylate and methyl benzoate from rice. Plant Physiol. Biochem. 48(4):279-287. [https://doi.org/10.1016/j.plaphy.2010.01.023]
  • Zhao R, Wang H-H, Gao J, Zhang Y-J, Li X, et al., 2022. Plant volatile compound methyl benzoate is highly effective against Spodoptera frugiperda and safe to non-target organisms as an eco-friendly botanical-insecticide. Environ. Safe. [https://doi.org/10.1016/j.ecoenv.2022.114101]
Author Information and Contributions

Jae Sang Yu, Department of Smart Agriculture Systems, Chungnam National University, Master student, https://orcid.org/0009-0002-2195-4244, Research design, Investigation, Data analysis, Writing original draft preparation.

Won Seok Lee, Department of Applied Biology, Chungnam National University, Bachelor, Experiment design, Rearing, Bioassay.

Keon Mook Seong, Department of Applied Biology and Smart Agriculture Systems, Chungnam National University, Professor, https://orcid.org/0000-0001-9780-9241, Writing-review and Editing

Fig. 1.

Fig. 1.
Effects of methyl benzoate and pyriproxyfen on the larval growth of T. castaneum. (A) Average body length (mm) of larvae over time. (B) Average body weight (mg) of larvae over time. (C) Linear regression of body length (mm) by days after treatment. (D) Linear regression of body weight (mg) by days after treatment. Colored lines in (C) and (D) represent the regression models fitted to each treatment group (Control, Methyl benzoate, Pyriproxyfen). Slope (B) and R² values are reported in the main text. Each dot represents the mean value at a given time point from repeated experiments.

Fig. 2.

Fig. 2.
Effects of treatments (Methyl benzoate and Pyriproxyfen) on larval period and survival. The control group was untreated, and all individuals were monitored until pupation, whereas in the treated groups observations continued until the insects failed to pupate and died. (A) Larval period (days) by treatment. Boxes show the interquartile range (IQR), the red line indicates the median, and points represent individual observations. (B) Kaplan–Meier larval survival curves for Control (blue), Pyriproxyfen (green), and Methyl benzoate (red). Overall log-rank test: χ²(2) = 507.2, P < 0.001. Sample sizes: Control n = 300, Methyl benzoate n = 300, Pyriproxyfen n = 300.

Fig. 3.

Fig. 3.
Relative expression levels of juvenile hormone- and ecdysone-related genes in T. castaneum larvae after treatment with methyl benzoate and pyriproxyfen. Gene expression was measured at 24 h and 48 h after treatment using RT-qPCR and is shown as 2–ΔΔCt values. (A) JHAMT; (B) JHE; (C) JHEH; (D) BR-C; (E) Kr-h1; (F) MET. Different letters indicate statistically significant differences between groups at each time point (p < 0.05, Tukey’s HSD test). Error bars represent standard error of the mean (SEM).

Table 1.

Primer sequences used in this study for RT-qPCR analyses

Genes Direction Primer sequences (5’-3’) Amplicon size (bp) Tm (℃)
JHAMT Forward
Reverse
TGCCAGCAACCCGATTTA
ATTCTCCAGCTCGGTTTCAG
133 62
JHE Forward
Reverse
CTCGAGAGCTTACATGTCCTTC
GCGTCCTTGGTTCCGTTTAT
123 62
JHEH Forward
Reverse
CGCTTATCGCCCAACAAATG
CCACCCATGAAGGGTACAAA
132 62
BR-C Forward
Reverse
GAACGAGGAGAACGTGAAGAG
CGGCCCTTGAGGTAGATTATTAG
124 62
Kr-h1 Forward
Reverse
CTACGTGTGTACGGTTTGCT
GTGGTTGTAGCCGAAGGATT
127 62
MET Forward
Reverse
GATTGACGGCCGCATAATTG
CATCACCCATCGAACATCCT
124 62

Table 2.

Toxic effects of methyl benzoate and pyriproxyfen on Tribolium castaneum larvae and adults

Insecticide Stage LD50a) 95% CL Slope (±SE) χ2 (df, p)
a)Lethal Dose 50%. b) mg. c) μl.
Pyriproxyfen Larva 131.743b) 84.841−214.024 0.737±0.084 3.381(4, 0.486)
Adult - - - -
Methyl benzoate Larva 34.403c) 21.736−53.530 0.676±0.075 9.720(5, 0.084)
Adult 3.921c) 3.096−4.893 0.448±0.038 16.054(6, 0.013)