The Korean Society of Pesticide Science

Editorial Board

The Korean Journal of Pesticide Science - Vol. 26, No. 2

[ ORIGINAL ARTICLES ]
The Korean Journal of Pesticide Science - Vol. 26, No. 2, pp. 140-149
Abbreviation: Korean J. Pestic. Sci.
ISSN: 1226-6183 (Print) 2287-2051 (Online)
Print publication date 30 Jun 2022
Received 20 May 2022 Revised 14 Jun 2022 Accepted 15 Jun 2022
DOI: https://doi.org/10.7585/kjps.2022.26.2.140

Fenvalerate와 imidacloprid 저항성 야외집단 목화진딧물에 대한 점 돌연변이 분석과 우수 약제 선발 및 방제체계
이종민1 ; 전종찬1 ; 강원진1 ; 김현경1 ; 박부용2 ; 구현나1 ; 김길하1, *
1충북대학교 식물의학과
2국립농업과학원 농산물안전성부 작물보호과

Analysis of Point Mutations Associated with Fenvalerate-and Imidacloprid-resistant Cotton Aphids, Aphis gossypii (Hemiptera: Aphididae) and Selection of Insecticides for Effective Control
Jong Min Lee1 ; Jong Chan Jeon1 ; Won Jin Kang1 ; Hyun Kyung Kim1 ; Bueyong Park2 ; Hyun-Na Koo1 ; Gil-Hah Kim1, *
1Department of Plant Medicine, Chungbuk National University, Cheongju 28644, Korea
2Crop Protection Division, Department of Agro-Food Safety and Crop protection, National Institute of Agricultural Sciences, Wanju 55365, Korea
Correspondence to : *E-mail: khkim@chungbuk.ac.kr

Funding Information ▼

초록

본 연구에서는 야외집단 목화진딧물의 점 돌연변이 분석, 약제저항성집단 방제를 위한 우수한 약제 선발, 그리고 체계적인 방제 전략을 설정하였다. 감수성 계통과 6개 야외집단에 대해 7개 약제의 감수성을 평가한 결과, 약제 모두에서 55% 미만의 저조한 살충률을 보였다. 저항성 점 돌연변이 분석 결과, λ-cyhalothrin 저항성 관련 점 돌연변이 L1014F는 발견되지 않았고, M918L (fenvalerate 저항성 관련 점 돌연변이)와 R81T (imidacloprid 저항성 관련 점 돌연변이)는 모든 집단에서 발견되었다. 목화진딧물 약제저항성집단 방제를 위한 우수 약제를 선발하기 위해 11개 약제를 처리한 결과, cyantraniliprole, pymetrozine, 그리고 afidopyropen 등 3개 약제가 90% 이상의 살충률을 보였으며 LT50값이 52 h 미만으로 다른 약제보다 효과가 좋았다. 이들 3개 약제와 작용기작이 다른 약제(bifenthrin, sulfoxaflor, spirotetramat)를 교호살포 했을 경우, 방제 효과가 우수하게 나타났다.

Abstract

In this study, we analyzed the point mutations of the field-collected cotton aphids, Aphis gossypii Glover, and selected effective insecticide and established the integrated pest management programs. The susceptible strain and the six field populations showed low mortality of less than 55% against seven insecticides. As a result of point mutation analysis, L1014F (λ-cyhalothrin resistance-related point mutation) was not found, and M918L (fenvalerate resistance-related point mutation) and R81T (imidacloprid resistance-related point mutation) were found in all populations. To select effective insecticides against resistant aphids, 11 insecticides were treated in the susceptible strain and the six field populations. As a result, three insecticides (cyantraniliprole, pymetrozine and afidopyropen) showed over 90% of the corrected mortality. In addition, the LT50 value was less than 52 h, which was more effective than other insecticides. When these three insecticides and insecticides with different mode of action (bifenthrin, sulfoxaflor, spirotetramat) were alternately sprayed, the control effect was the most excellent.


Keywords: Aphis gossypii, point mutation, fenvalerate, imidacloprid, systematic treatment strategy
키워드: 목화진딧물, 점 돌연변이, 저항성, 방제체계

서 론

목화진딧물(Aphis gossypii)은 전 세계적으로 발생하여 박과(멜론, 수박, 호박), 아욱과(목화, 무궁화), 가지과(고추, 토마토, 가지), 운향과(감귤, 과수), 감자 등에 가해하여 피해를 일으키는 주요 해충이다(Blackman and Eastop., 2000; Carletto et al., 2009). 목화진딧물을 방제하기 위해 많은 살충제가 사용되어왔지만, 짧은 생활사와 많은 세대수로 인하여 농약에 대한 약제 저항성 발달이 쉬워 방제에 큰 어려움이 있다(Saito et al., 1995; Herron and Wilson, 2017; Pan et al., 2015).

우리나라에선 기주식물이 약 130종 이상으로 기록되어있고, 약 75종의 식물바이러스병을 매개하는 것으로 알려져 있다(Kim, 2008; Kim et al., 2015). 또한, 식물체를 흡즙하여 식물의 생장저하, 수확량 감소, 감로로 인한 그을음병 유발과 그로 인한 상품가치가 떨어지는 피해를 주고 있다. 그러나 무분별한 약제 살포로 유기인계, 카바메이트계, 피레스로이드계, 네오니코티노이드계 등 해가 거듭될수록 저항성의 정도가 점점 높아지는 양상을 보인다(Herron et al., 2001; Ahmad and Arif, 2008; Koo et al., 2014; Matsuura et al., 2014; Chen et al., 2017; Gul et al., 2019). 따라서 본 연구에서는 국내 6개 지역(충남 예산, 경남 남해, 전남 구례, 경북 상주, 세종, 충북 청주)에서 목화진딧물을 채집하여 imidacloprid와 fenvalerate에 대한 저항성 발달수준을 평가하였고, 약제 저항성관련 target 유전자에서 점 돌연변이(R81T, M918L)의 발생 여부를 확인하였다. 또한 저항성 목화진딧물 방제를 위한 우수 약제를 선발하여 방제체계 전략을 제시하고자 본 연구를 수행하였다.


재료 및 방법
시험곤충

본 실험에 사용한 목화진딧물 감수성 계통(S)은 2021년 국립 농업과학원 곤충사육실에서 누대 사육해온 실험실 개체를 분양받은 것으로 충북대학교 식물의학과 곤충생태 및 독성학실험실 사육실에서 농약을 처리하지 않은 오이를 기주로 사육하였다. 야외집단 목화진딧물은 충청북도 청주시, 충청남도 예산군, 세종특별자치시, 경상북도 상주시, 경상남도 남해군, 전라남도 구례군에서 채집하였으며 실내에서 2주 이상의 기간을 두고 사육한 후 실험에 사용하였다. 자세한 채집일, 채집지역 및 기주식물은 Table 1과 같다. 실내 사육조건은 온도 21-23oC, 광주기 16L:8D, 상대습도 50-60%로 조절하였다.

Table 1. 
Information of A. gossypii populations which collected from field
Populations Date collected Region Host
Yesan (YS) 2021. 08. Sinam-myeon, Yesan-gun Cucumber
Namhae (NH) 2021. 08. Seolcheon-myeon, Namhae-gun Cucumber
Gurye (GR) 2021. 05. Yongbang-myeon, Gurye-gun Cucumber
Sangju (SJ1) 2021. 08. Modong-myeon, Sangju-si Cucumber
Sejong (SJ2) 2021. 07 Yeonseo-myeon, Sejong-si Cucumber
Chungju (CJ) 2021. 05. Heungdeok-gu, Cheongju-si Cucumber

시험약제

실험에 사용된 살충제는 저항성 수준을 알아보기 위한 살충제 7종과 대체 약제 선발용 살충제 11종 등 총 18종으로 시판되고 있는 제품을 사용하였으며, 약제의 일반명과 유효성분, 제형 및 추천농도 등은 Table 2와 같다.

Table 2. 
Information of the tested insecticides
Common name Mode of action AIa) (%) Formulationb) Recommended conc. (ppm)
α-cypermethrin 3a 2 EC 20
Bifenthrin 3a 1 EC 10
Esfenvalerate 3a 1.5 EC 15
Fenvalerate 3a 5 EC 50
λ-cyhalothrin 3a 1 EC 10
Acetamiprid 4a 8 WP 40
Clothianidin 4a 8 SG 40
Dinotefuran 4a 20 WG 100
Imidacloprid 4a 8 SC 40
Thiacloprid 4a 10 SC 50
Thiamethoxam 4a 10 WG 50
Sulfoxaflor 4c 7 SC 35
Flupyradifurone 4d 17.09 SL 85.45
Pymetrozine 9b 49 WG 98
Pyrifluquinazone 9b 10 WG 50
Afidopyropen 9d 2.5 ME 12.5
Spirotetramat 23 22 SC 110
Cyantraniliprole 28 10.26 OD 51.3
a) Active Ingredient.
b) EC; emulsifiable concentrate, WP; wettable powder, SC; suspension concentrate, WG; water dispersible granules, SL; soluble concentrate, ME; micro-emulsion, OD; oil dispersion.

약제 감수성 평가

약제 감수성은 목화진딧물의 성충에 대하여 실시하였다. 오이 잎을 ϕ 5.0 cm로 잘라 각각 희석한 약액에 침지하여 오이 잎 표면의 물기가 다 마르도록 음건 시켰다. ϕ 5.0 cm petri-dish에 1% agar를 깔고 그 위에 음건시킨 오이 잎을 올린 후 목화진딧물 무시성충을 접종하였고, 약제처리 후 온도 21-23oC, 광주기 16L:8D, 상대습도 50-60%의 조건에 두고 24, 48, 72, 96시간 후 사충수를 조사하였다. 실험은 3반복으로 실시하였고, 보정살충률은 Abbott’s formula를 이용하여 구했으며(Abbott, 1925), Probit analysis (Finney, 1971)로 LT50 (Median of lethal time) 값을 구하였다.

저항성 유전자 PCR 및 서열 분석

목화진딧물의 genomic DNA는 G-spinTM Total DNA Extraction Mini Kit (Intron, Seongnam, Korea)를 사용하여 분리하였다. 100마리의 무시성충을 사용하였으며 200 ng의 gDNA를 PCR에 사용하였다(AccuPower® ProFi Taq PCR PreMix, Bioneer Co., Daejeon, Korea). 100마리의 무시 성충을 homogenizer를 사용하여 균질화한 후 20 uL의 proteinase K와 5 uL의 RNase를 첨가하여 56oC에서 30분 반응시킨 다음 binding column tube를 사용하여 genomic DNA를 추출하였다. PCR 반응은 1 μl (5 pmol) template와 Accupower® Hotstart PCR premix (Bioneer, Daejeon, Republic of Korea)로 94oC에서 5분, 94oC에서 30초, 60oC에서 30초, 72oC에서 1분(35 cycles), 72oC에서 5분간 반응시켰다. 정제한 PCR 산물은 sequencing 하여 비교분석하였다(Macrogen, Seoul, Republic of Korea). 실험에 사용한 primer 정보는 Table 3과 같다.

Table 3. 
Primers used for amplification and sequencing
Insecticide Gene Mutation Primer Primer sequence (5`-3`) References
Imidacloprid nAChR R81T CA_GPA_b1-F GGCCGTGTTCTTCGTCTGTTCA Koo et al., 2014
CA_GPA_b1-R CCCAAGTTCCGGATTTCCAGTAGT
λ-cyhalothrin vgsc L1014F KDR_DPI1 TCTTGGCCCACACTTAATCTTT Marshall et al., 2012
KDR_DPI4 CTCGCCGTTTGCATCTTATT
Fenvalerate M918L Ag-F GTGCCTAACGGTCACTAT Chen et al., 2017
Ag-R CAGATGCCAAGAAGAATG

방제체계 전략 프로그램

포장시험은 실내검정 결과 우수한 효과를 나타낸 약제와 저항성을 보인 약제를 교호 살포하여 방제체계 전략을 구상하였다. 약제는 작용기작이 다른 약제를 처리할 수 있도록 선발하였다. 야외 6개 지역의 목화진딧물을 방사하여 구당 200마리 이상 접종하였다. 오이 농가의 관행적인 살균제(흰가루병) 처리 간격에 맞춰 10일 간격으로 3회 경엽처리 하였다. 실외검정은 충북대학교 시설 포장(비닐하우스)에서 수행하였으며 구당 3주씩 난괴법 3반복으로 수행하였으며, 최종 약제처리 7일 후 목화진딧물의 생충수를 조사하였으며, 각 처리구별로 평균 생충수를 구해 방제가를 산출하였다.

데이터 분석

목화진딧물에 대한 실험결과는 Finney (1971)의 probit 분석법으로 LT 값을 구하였고, 보정살충률은 채집지역과 약제처리 후 경과시간별로 Tukey’s studentized range test를 이용하여 비교분석 하였다(SAS Institute 9.4, SAS Inc.).


결 과
지역별 약제 감수성 평가

감수성 계통과 6개 지역에서 채집한 야외집단(YS, NH, GR, SJ1, SJ2, CJ) 목화진딧물에 대해 fenvalerate, λ-cyhalothrin, acetamiprid, clothianidin, dinotefuran, imidacloprid, 그리고 thiamethoxam 등 7종 약제의 추천농도에서 약제 감수성을 평가하였다(Table 4). 그 결과, 7종의 약제 모두 6개 야외채집 집단에 대해 55% 이하의 살충률을 보였으며 감수성 계통은 100%의 살충률을 보였다. 특히 fenvalerate의 경우 SJ2 집단을 제외한 모든 지역에서 20.4% 이하의 낮은 살충률을 나타내었다. λ-cyhalothrin은 YS와 GR 집단에서 6.7%의 살충률을 보였고 나머지 4개 집단도 13.7~41.9%의 낮은 살충률을 보였다. Acetamiprid의 경우 SJ2 집단을 제외한 모든 지역에서 31.1% 이하의 살충률을, clothianidin과 dinotefuran의 경우에도 각각 45.2%, 44.8% 이하의 낮은 살충률을 나타냈다. Imidacloprid의 경우 14.1~33.7%의 낮은 살충률을 보였고, thiamethoxam은 30.7~53.3%의 살충률을 나타냈다.

Table 4. 
Susceptibility to 7 insecticides in the S strain and field-collected populations of A. gossypii
Populations Insecticide na) Mortality (%) Insecticide na) Mortality (%)
S Fenvalerate 60 100.0 ± 0.0a λ-cyhalothrin 60 100.0 ± 0.0a
YS 60 10.4 ± 5.8b 60 6.7 ± 9.2c
NH 60 13.7 ± 3.2b 60 13.7 ± 3.2bc
GR 60 17.4 ± 3.8b 60 6.7 ± 6.7c
SJ1 60 13.3 ± 8.8b 60 37.8 ± 6.2bc
SJ2 60 37.4 ± 8.1b 60 41.9 ± 7.4b
CJ 60 20.4 ± 5.5b 60 27.0 ± 8.5bc
S Acetamiprid 60 100.0 ± 0.0a Clothianidin 60 100.0 ± 0.0a
YS 60 17.4 ± 6.3c 60 21.1 ± 5.5b
NH 60 24.1 ± 3.0c 60 24.1 ± 3.0b
GR 60 24.1 ± 3.0c 60 23.7 ± 6.3b
SJ1 60 27.4 ± 6.3c 60 27.0 ± 11.8b
SJ2 60 54.8 ± 5.2b 60 44.4 ± 8.0b
CJ 60 31.1 ± 5.9c 60 45.2 ± 7.8b
S Dinotefuran 60 100.0 ± 0.0a Imidacloprid 60 100.0 ± 0.0a
YS 60 28.5 ± 3.3b 60 14.1 ± 3.0b
NH 60 34.1 ± 8.3b 60 27.4 ± 2.6b
GR 60 30.4 ± 11.2b 60 23.7 ± 8.5b
SJ1 60 38.1 ± 4.3b 60 30.7 ± 5.2b
SJ2 60 44.8 ± 2.9b 60 33.7 ± 11.7b
CJ 60 27.0 ± 11.8b 60 31.5 ± 7.1b
S Thiamethoxam 60 100.0 ± 0.0a
YS 60 53.3 ± 4.6b
NH 60 30.7 ± 5.2b
GR 60 47.8 ± 7.8b
SJ1 60 31.1 ± 5.9b
SJ2 60 44.4 ± 8.0b
CJ 60 41.5 ± 6.0b
a)n, The number of apterous viviparous female of A. gossypii.

저항성 점 돌연변이 확인

모든 목화진딧물 집단에 대해 λ-cyhalothrin과 fenvalerate 저항성 관련 점 돌연변이 확인은 voltage-gated sodium channel (vgsc) 유전자에서 조사하였다(Table 5). 그 결과, λ-cyhalothrin 저항성 관련 점 돌연변이 L1014F는 모든 야외집단에서 발견되지 않았고, fenvalerate 저항성 관련 점 돌연변이 M918L은 채집한 모든 집단에서 확인되었다. Imidacloprid 저항성 관련 점 돌연변이 R81T는 nicotinic acetylcholine receptors (nAChRs) 유전자에서 확인한 결과, 모든 집단에서 heterotype으로 혼재되어 있음을 확인하였다.

Table 5. 
Genotype by general sequencing for target site mutation in A. gossypii
Insecticide Target site Point mutation Population
S YS NH GR SJ1 SJ2 CJ
Fenvalerate vgsc M918L M L L L L L L
λ-cyhalothrin L1014F L L L L L L L
Imidacloprid nAChR R81T R R/T R/T R/T R/T R/T R/T

우수 약제 선발

6개 지역에서 채집한 목화진딧물 방제에 효과가 우수한 약제를 선발하기 위해 α-cypermethrin, bifenthrin, esfenvalerate, thiacloprid, sulfoxaflor, flupyradifurone, pymetrozine, pyrifluquinazone, afidopyropen, spirotetramat, cyantraniliprole 등 11종 약제를 추천농도로 처리하였다(Table 6). 그 결과, α-cypermethrin에서 75% 이상, bifenthrin에서 80% 이상의 살충률을 나타내었다. Esfenvalerate의 경우 60~70%의 살충률을 보였고, thiacloprid에서는 YS, GR, 그리고 SJ1 집단에서 69% 이상의 살충률을 나타내었다. Sulfoxaflor의 경우 SJ2 집단과 CJ 집단을 제외한 모든 지역에서 80% 이상의 살충률을 보였으며 flupyradifurone은 GR 집단을 제외한 모든 지역에서 70% 이하의 살충률을 나타내었다. Pymetrozine의 경우 모든 지역에서 90% 이상의 살충률을 보였고, pyrifluquinazone의 경우 70~80%대의 살충률을 나타내었다. Afidopyropen의 경우 모든 지역에서 85% 이상의 살충률을 나타내었고, spirotetramat은 모든 지역에서 70%대의 살충률을, cyantraniliprole은 모든 지역에서 90% 이상의 살충률을 보였다. 살충속도(LT50)는 α-cypermethrin, bifenthrin과 pyrifluquinazone에서 40~50 h로 나타났으며, esfenvalerate는 60~70 h의 살충 속도를 보였다(Table 7). Afidopyropen은 45h 미만, cyantraniliprole은 30~40 h, pymetrozine은 55 h 미만의 살충 속도를 보였다. Sulfoxaflor에서 65 h 미만, spirotetramat에서 70 h 이하, flupyradifurone에서 85 h 이하의 살충 속도를 나타내었다. Thiacloprid는 40~110 h의 살충속도를 보였다.

Table 6. 
Susceptibility to 11 insecticides in the S and field-collected populations of A. gossypii
Strain Insecticide na) Mortality(%) Insecticide na) Mortality(%) Insecticide na) Mortality(%) Insecticide na) Mortality(%)
S α-cypermethrin 60 100.0±0.0a Bifenthrin 60 100.0±0.0a Esfenvalerate 60 100.0±0.0a Thiacloprid 60 100.0±0.0a
YS 60 75.2±6.9c 60 92.6±3.7a 60 71.5±3.3b 60 85.6±3.9ab
NH 60 96.7±3.3ab 60 90.0±5.8a 60 68.9±5.9b 60 51.5±9.4cd
GR 60 83.0±3.0abc 60 85.9±4.1a 60 68.5±7.1b 60 69.3±5.2bcd
SJ1 60 75.9±3.0c 60 89.3±6.4a 60 72.2±4.0b 60 78.9±6.7abc
SJ2 60 79.3±5.8bc 60 83.0±3.0a 60 72.2±4.0b 60 48.5±4.6d
CJ 60 82.6±3.8abc 60 89.6±5.8a 60 69.3±5.2b 60 44.4±5.6d
S Sulfoxaflor 60 100.0±0.0a Flupyradifurone 60 100.0±0.0a Pymetrozine 60 100.0±0.0a Pyrifluquinazone 60 100.0±0.0a
YS 60 96.3±3.7a 60 61.1±5.6b 60 100.0±0.0a 60 89.3±0.4a
NH 60 83.0±6.5ab 60 61.9±4.3b 60 93.3±3.3a 60 79.6±5.5a
GR 60 82.6±3.8ab 60 75.6±4.4ab 60 93.0±3.5a 60 86.3±3.2a
SJ1 60 89.3±6.4ab 60 68.9±5.9b 60 96.3±3.7a 60 89.6±5.8a
SJ2 60 69.3±5.2b 60 55.2±8.7b 60 90.0±5.8a 60 79.3±5.8a
CJ 60 72.2±4.0b 60 58.5±6.0b 60 96.7±3.3a 60 90.0±5.8a
S Afidopyropen 60 100.0±0.0a Spirotetramat 60 100.0±0.0a Cyantraniliprole 60 100.0±0.0a
YS 60 89.3±0.4a 60 74.8±4.1b 60 100.0±0.0a
NH 60 89.6±5.8a 60 72.6±2.6b 60 93.0±3.5a
GR 60 93.0±3.5a 60 79.6±5.5b 60 96.3±3.7a
SJ1 60 93.0±3.5a 60 76.3±6.3b 60 96.7±3.3a
SJ2 60 89.3±6.4a 60 79.3±0.7b 60 93.0±3.5a
CJ 60 96.3±3.7a 60 75.9±3.0b 60 96.7±3.3a
a)n, The number of apterous viviparous female of A. gossypii.

Table 7. 
Median lethal time (LT50) of 11 insecticides in the S strain and field-collected populations of A. gossypii
Strain Insecticide na) LT50(h) (95% CL)b) Insecticide na) LT50(h) (95% CL)b)
S α-cypermethrin 60 14.5 (12.6-16.3) Bifenthrin 60 10.8 (8.7-12.7)
YS 60 46.9 (41.1-52.7) 60 41.7 (38.4-44.9)
NH 60 50.2 (46.7-53.8) 60 50.2 (46.7-53.8)
GR 60 51.7 (47.1-56.5) 60 45.5 (41.6-49.3)
SJ1 60 54.4 (49.0-60.2) 60 47.9 (43.6-52.2)
SJ2 60 59.5 (54.6-65.0) 60 44.3 (39.6-48.8)
CJ 60 50.6 (45.8-55.7) 60 41.1 (36.8-45.3)
S Esfenvalerate 60 19.1 (17.3-21.0) Thiacloprid 60 28.9 (26.5-31.3)
YS 60 73.8 (68.2-80.5) 60 45.8 (41.1-50.5)
NH 60 74.4 (65.1-88.7) 60 77.3 (67.5-92.8)
GR 60 76.0 (67.5-88.2) 60 66.0 (58.7-75.5)
SJ1 60 69.8 (61.5-81.7) 60 59.8 (55.0-65.1)
SJ2 60 68.8 (61.0-79.5) 60 100.4 (85.6-128.6)
CJ 60 75.8 (67.9-86.9) 60 111.8 (91.3-158.6)
S Sulfoxaflor 60 25.8 (23.6-28.0) Flupyradifurone 60 21.6 (18.4-24.8)
YS 60 44.2 (40.5-47.8) 60 51.4 (39.4-65.8)
NH 60 52.8 (45.8-60.6) 60 63.9 (55.5-75.2)
GR 60 34.0 (27.4-39.7) 60 45.9 (39.6-52.1)
SJ1 60 37.5 (31.7-42.8) 60 51.8 (40.5-65.5)
SJ2 60 62.3 (56.5-69.0) 60 84.1 (74.1-100.0)
CJ 60 44.8 (37.0-52.4) 60 76.0 (64.0-97.4)
S Pymetrozine 60 29.8 (26.9-32.8) Pyrifluquinazone 60 17.8 (15.8-19.8)
YS 60 33.6 (28.5-38.2) 60 41.5 (37.6-45.3)
NH 60 33.5 (28.0-38.4) 60 53.1 (46.8-60.2)
GR 60 21.4 (13.7-27.5) 60 46.4 (41.1-51.8)
SJ1 60 48.4 (44.0-52.8) 60 46.9 (41.2-52.8)
SJ2 60 52.7 (48.4-57.1) 60 51.1 (45.8-56.7)
CJ 60 36.2 (31.9-40.1) 60 53.4 (48.6-58.5)
S Afidopyropen 60 31.9 (29.3-34.7) Spirotetramat 60 44.7 (41.3-48.3)
YS 60 43.9 (39.6-48.1) 60 49.6 (43.2-56.3)
NH 60 41.7 (37.3-46.0) 60 59.2 (53.5-65.9)
GR 60 41.7 (36.6-46.6) 60 54.9 (49.0-61.6)
SJ1 60 44.4 (40.6-48.3) 60 63.0 (57.9-68.7)
SJ2 60 43.0 (38.5-47.5) 60 57.9 (53.2-62.9)
CJ 60 41.6 (37.8-45.4) 60 70.6 (63.6-79.8)
S Cyantraniliprole 60 20.1 (16.9-23.2)
YS 60 46.0 (42.0-50.2)
NH 60 33.9 (28.9-38.4)
GR 60 33.2 (28.1-37.6)
SJ1 60 32.0 (27.5-36.0)
SJ2 60 38.6 (34.0-42.8)
CJ 60 33.1 (28.6-37.2)
a)n, The number of apterous viviparous female of A. gossypii.
b)CL, Confidence limits.

방제체계 전략 프로그램

위에서 얻은 결과로 방제체계 전략을 수립하였다(Table 8). 평균 살충률과 LT50값이 가장 우수한 약제를 각 약제의 계통과 특성을 고려하여 선발하였다. 피레스로이드계 약제 중 가장 저조한 효과를 보인 fenvalerate와 네오니코티노이드계통 중 가장 저조한 효과를 보인 imidac loprid를 대조군 약제로 선발하였으며, 대조군 약제는 strategy 3에서 1회, strategy 4에서 2회 처리하였다. 그 외에 약제처리 순서는 계통이 중복되지 않게 무작위로 설정하였다. 실내사육 시 오이를 기주로 제공했기 때문에 원활한 접종을 고려해 오이를 기주로 선정하였고, 접종 2일 후 목화진딧물이 기주식물에 정착됐음을 확인하고 약제처리를 실시하였다. 그 결과, strategy 1과 2는 98%로 매우 우수한 방제 효과를 보였고, 대조군 약제가 1회 처리된 strategy 3은 94%의 방제 효과를 보였다(Table 9). 대조군 약제를 2회 처리한 strategy 4에서는 85%로 다소 낮은 방제 효과를 보였다.

Table 8. 
Tested insecticides and systematic treatment strategies
Treatment strategies Treatment number (interval 10 days)
1st 2nd 3rd
1 Bifenthrin EC Sulfoxaflor SC Afidopyropen ME
2 Pymetrozine WG Cyantraniliprole OD Bifenthrin EC
3 Imidacloprid SC Cyantraniliprole OD Spirotetramat SC
4 Imidacloprid SC Fenvalerate EC Spirotetramat SC
Untreated -a) - -
a)No treatment.

Table 9. 
Comparison of systematic treatment strategies to control A. gossypii on cucumber plastic house
Treatment strategies Treatment number (interval 10 days) 7 days after 3rd treatment
1st 2nd 3rd No. of survival (Mean ± SE) Control value (%)
1 BIa) SU AF 11.7 ± 2.0cc) 98.5
2 PY CY BI 13.7 ± 2.0c 98.3
3 IM CY SP 39.7 ± 4.6c 94.9
4 IM FE SP 114.3 ± 10.4b 85.4
Untreated -b) - - 783.7 ± 41.9a -
a)BI: Bifenthrin EC, SU: Sulfoxaflor SC, AF: Afidopyropen ME, PY: Pymetrozine WG, CY: Cyantraniliprole OD, IM: Imidacloprid SC, SP: Spirotetramat SC, FE: Fenvalerate EC.
b)No treatment.
c)Means followed by the same letters are not significantly different (p < 0.05; Tukey’s studentized range test (SAS Institute 9.4).


고 찰

본 연구는 야외집단 목화진딧물의 점 돌연변이 분석과 저항성 개체 방제를 위한 우수한 약제를 선발하고 그에 따라 체계적인 방제 전략을 설정하였다. 국내 예산, 남해, 구례, 상주, 세종, 청주 등 6개 지역에서 채집한 목화진딧물에 대해 약제저항성 수준을 조사한 결과, 피레스로이드계인 fenvalerate와 λ-cyhalothrin, 네오니코티노이드계인 acetamiprid, clothianidin, dinotefuran, imidacloprid 그리고 thiamethoxam에 대해 55% 미만의 저조한 살충률을 나타내었다. 이에 따라 저항성 기작 관련 유전자의 점 돌연변이를 분석하였을 때 모든 지역에서 nAChR 유전자의 점 돌연변이 R81T와 vgsc 유전자의 점 돌연변이 M918L의 발현을 확인할 수 있었으나, L1014F는 보이지 않았다. Chen 등(2017)은 중국에서 M918L과 L1014F가 동시에 발현된 개체가 관찰된 적이 없다고 보고하였으며 본 연구 또한 같은 양상을 보였다. 점돌연변이 M918L은 목화진딧물, 복숭아혹진딧물, 기장테두리진딧물, 콩진딧물, 파총채벌레 등 다양한 해충에서 λ-cyhalothrin을 포함한 피레스로이드계통 약제에 대하여 저항성을 나타낸다고 알려져 있다(Carletto et al., 2010; Fontaine et al., 2011; Wu et al., 2014; Wang et al., 2020; Pires Paula et al., 2021). 또한 본 연구에서도 점 돌연변이 L1014F가 발현되지 않았지만 λ-cyhalothrin에 대한 살충률이 저조하여(45% 미만) 국내 목화진딧물 야외집단에서 L1014F가 저항성 모니터링을 위한 분자진단 마커로서는 적합하지 않다고 여겨진다. Choi 등(2005)의 목화진딧물 모니터링 결과에서는 유기인계와 카바메이트계 등 과거에 많이 사용되었던 약제에서 높은 저항성을 보이지 않아 감수성이 회복된 것으로 판단하였으나, 본 연구에서 유기인계, 카바메이트계와 교차저항성을 보이는 점 돌연변이 M918L의 발현을 확인하였으며, α-cypermethrin과 bifenthrin을 제외한 피레스로이드 계통 약제의 추천농도에서 다소 낮은 살충률을 확인하였다. Shi 등(2011)은 목화진딧물 imidacloprid 저항성 개체에 대해서 dinotefuran, thiamethoxam과 clothianidin이 교차저항성을 보이지 않는다고 보고하였으나, 본 연구에서는 imidacloprid에서 25% 미만, acetamiprid에서 55% 미만, clothianidin에서 45% 미만, dinotefuran에서 45% 미만, 그리고 thiamethoxam에서 55% 미만의 낮은 살충률을 보였다. Koo 등(2014)은 imidacloprid 저항성 목화진딧물은 네오니코티노이드계 약제(acetamiprid, clothianidin, dinotefuran, thiacloprid, thiamethoxam)에서 교차저항성을 보인다고 보고하였다. Thiacloprid는 살충률이 44~85%로, LT50값은 45~111 h로 지역별로 차이를 보였다. 또한, Koo 등(2014)은 imidacloprid 저항성 개체에 대해 sulfoxaflor가 역상관교차 저항성을 보인다고 보고하였고, 본 실험에서도 SJ2 지역과 CJ지역을 제외하면, 80% 이상의 살충률을 보였다. 최근 2016년부터 2019년까지 4년 동안 국내 40개 지역에서 채집한 목화진딧물에서 저항성 점 돌연변이 R81T와 M918L의 발현을 보여 본 연구와 비슷한 결과를 확인할 수 있었고(Nam, 2021), 또한 중국 지역에서도 목화진딧물의 저항성점 돌연변이 R81T와 M918L가 같이 발현하는 양상을 보여(Munkhbayar et al. 2021), 전국적으로 목화진딧물에 대한 유기인계, 네오니코티노이드계 저항성 발달이 우려되는 실정이다.

이러한 약제저항성 목화진딧물의 효율적인 방제를 위한 우수 약제 선발 결과, cyantraniliprole과 pymetrozine, afidopyropen이 각각 95.9%, 94.9%, 91.7%의 방제 효과를 나타냈고, LT50에서도 36.1 h, 37.6 h, 42.7 h로 가장 빠른 수치를 보였다. Cyantraniliprole은 diamide계 살충제로 Ryanodine receptors (RyRs)와 결합하여 근육을 마비시키는 작용기작으로 나비목과 흡즙성 곤충에 대해 효과가 있는 것으로 알려져 있으며(Sattelle et al., 2008), 2012년 제품명 ‘토리치’로 처음 국내에 등록되었다(PSIS, 2021). 위 3개 약제 중 afidopyropen은 IRAC code 9d 그룹에 있는 살충제로 미생물인 Aspergillus fumigatus (Eurotiales : Trichocomaceae)에 의해 생산된 발효산물 pyripyropene의 반합성 유도체이며 천연물질이라고 볼 수 있다(IRAC, 2021; Jeschke, 2017). 2020년 제품명 ‘세피나’, ‘베르시스’로 처음으로 등록되었다(PSIS, 2021). Pymetrozine은 IRAC code 9b 그룹으로 노린 재목에 선택독성이 있으며, 가루이류, 진딧물류에 효과가 있다. 2008년 제품명 ‘체스’로 국내 등록되었다(PSIS, 2021). 또한, Yang 등(2009)은 pymetrozine에서 imidac loprid 저항성 개체에 대해 교차저항성이 없다고 보고하였다. 따라서 이들 3개 약제는 피레스로이드 계통과 네오니코티노이드 계통 저항성이 높아진 목화진딧물 방제에 효과적으로 사용 가능할 것으로 보인다.

위의 3개 약제와 작용기작이 다른 약제 3종을 추가로 선발하여, 총 6개 약제로 방제체계 전략을 수립하여 프로그램을 적용한 결과, strategy 1, strategy 2에서 98% 이상의 매우 우수한 방제효과를 나타내었고, strategy 3에서 같은 유의차를 보이며 94% 이상의 방제효과를 보였다. 그러나 대조군으로 선정한 imidacloprid와 fenvalerate가 포함된 strategy 4에서는 다른 처리구와 다른 유의차를 나타내며 85%의 다소 낮은 방제효과를 나타내었다. 목화진딧물은 짧은 생활사와 많은 산자수를 가지고 있어 적은 수에서도 개체수가 폭발적으로 증가할 수 있으므로(Shim et al., 1979; Kim et al., 2004), 95% 미만의 방제효과를 보인 strategy 3과 4는 저항성이 발현된 목화진딧물 방제에 다소 부적합하다고 판단된다. 교호살포는 병해충의 저항성 발현 억제에 추천되는 처리법이며, 병해충의 생활사에 맞추어 작용기작이 다른 약제로 3회 교호살포하는 것을 권고하고 있다(IRAC 2021). 저항성이 발현된 목화진딧물이 발생한 포장에서는 저항성이 발현된 약제와 작용기작이 다른 약제를 3회 교호살포 하는 것이 저항성 목화진딧물의 방제에 이상적인 방제체계 전략이라고 판단된다.


Acknowledgments

본 결과물은 농촌진흥청 농작물 주요 해충에 대한 농약 저항성 조사(PJ016960022022) 과제를 통해 지원받았습니다.

이해상충관계

저자는 이해상충관계가 없음을 선언합니다.


References
1. Abbott WS, 1925. A method of computing the effectiveness of an insecticide. J. Econ. Entomol. 18(2):265-267.
2. Ahmad M, Arif MI, 2008. Susceptibility of Pakistani populations of cotton aphid Aphis gossypii (Homoptera: Aphididae) to endosulfan, organophosphorus and carbamate insecticides. Crop Prot. 27(3-5):523-531.
3. Blackman RL, Eastop VF, 2000. Aphids on the World’s Crops:An Identification and Information Guide. John Wiley & Sons, Chichester, UK.
4. Carletto J, Martin T, Vanlerberghe‐Masutti F, Brévault T, 2010. Insecticide resistance traits differ among and within host races in Aphis gossypii. Pest Manag. Sci. 66(3):301-307.
5. Carletto J, Lombaert E, Chavigny P, Brévault T, Lapchin L, et al., 2009. Ecological specialization of the aphid Aphis gossypii Glover on cultivated host plants. Mol. Ecol. 18(10):2198-2212.
6. Chen X, Tie M, Chen A, Ma K, Li F, et al., 2017. Pyrethroid resistance associated with M918L mutation and detoxifying metabolism in Aphis gossypii from Bt cotton growing regions of China. Pest Manag. Sci. 73(11):2353-2359.
7. Choi BR, Park HM, Yoo JK, Kim SG, Baik CH, et al., 2005. Monitoring on insecticide resistance of major insect pests in plastic house. Kor. J. Pestic. Sci. 9(4):380-390.
8. Finney DJ, 1971. Probit analysis. 3rd ed. Cambridge University Press, Cambridge. pp. 333.
9. Fontaine S, Caddoux L, Brazier C, Bertho C, Bertolla P, et al., 2011. Uncommon associations in target resistance among French populations of Myzus persicae from oilseed rape crops. Pest Manag. Sci. 67(8):881-885.
10. Gul H, Ullah F, Biondi A, Desneux N, Qian D, et al., 2019. Resistance against clothianidin and associated fitness costs in the chive maggot, Bradysia odoriphaga. Entomol. Gen. 39(2):81-92.
11. Herron GA, Powis K, Rophail J, 2001. Insecticide resistance in Aphis gossypii Glover (Hemiptera: Aphididae), a serious threat to Australian cotton. Australian J. Entomol. 40(1):85-91.
12. Herron GA, Wilson LJ, 2017. Can resistance management strategies recover insecticide susceptibility in pests?: a case study with cotton aphid Aphis gossypii (Aphididae: Hemiptera) in Australian cotton. Austral Entomol. 56(1):1-13.
13. Insecticide resistance action committee (IRAC), 2021. https://irac-online.org/modes-of-action/. (Assessed : 14th November 2021)
14. Jeschke P, 2017. Latest generation of halogen‐containing pesticides. Pest Manag. Sci. 73(6):1053-1066.
15. Kim JS, Kim YH, Kim TH, Kim JH, Byeon YW, et al., 2004. Temperature-dependent development and its model of the melon aphid, Aphis gossypii Glover (Homoptera: Aphididae). Kor. J. Appl. Entomol. 43(2):111-116.
16. Kim HJ, 2008. A systematic of the tribe Aphidini (Hemiptera: Aphididae) in the Korean peninsula, with discussion of their phylogenetic relationships based on molecular markers and morphology. Seoul National University, Seoul. Korea.
17. Kim TO, Kwon SH, Park JH, Oh SO, Hyun SY, et al., 2015. The colonizing routes of Aphis gossypii (Hemiptera: Aphididae) to Mandarine citrus trees grown in a non-heating plastic-film house during the early season. Kor. J. Appl. Entomol. 54(3):247-255.
18. Koo HN, An JJ, Park SE, Kim JI, Kim GH, 2014. Regional susceptibilities to 12 insecticides of melon and cotton aphid, Aphis gossypii (Hemiptera: Aphididae) and a point mutation associated with imidacloprid resistance. Crop Prot. 55:91-97.
19. Marshall KL, Moran C, Chen Y, Herron GA, 2012. Detection of kdr pyrethroid resistance in the cotton aphid, Aphis gossypii (Hemiptera: Aphididae), using a PCR-RFLP assay. J. Pestic. Sci. 37(2):169-172.
20. Matsuura A, Nakamura M, 2014. Development of neonicotinoid resistance in the cotton aphid Aphis gossypii (Hemiptera: Aphididae) in Japan. Appl. Entomol. Zoo. 49(4):535-540.
21. Munkhbayar O, Liu N, Li M, Qiu X, 2021. First report of voltage‐gated sodium channel M918V and molecular diagnostics of nicotinic acetylcholine receptor R81T in the cotton aphid. J. Appl. Entomol. 145(3):261-269.
22. Nam HY. 2021. Population genetic structure of Aphis gossypii (Hemiptera: Aphididae) in Korea, focusing on its relationship with fitness and insecticide resistance. Doctoral dissertation, Graduate School Seoul National University.
23. Pan Y, Peng T, Gao X, Zhang L, Yang C, et al., 2015. Transcriptomic comparison of thiamethoxam-resistance adaptation in resistant and susceptible strains of Aphis gossypii Glover. Comp. Biochem. Phys. Part D: Genomics Proteomics, 13:10-15.
24. Pires Paula D, Lozano RE, Menger JP, Andow DA, Koch RL, 2021. Identification of point mutations related to pyrethroid resistance in voltage-gated sodium channel genes in Aphis glycines. Entomol. Gen. 41(3):243-255.
25. Pesticide safety information system (PSIS). 2021. http://psis.rda.go.kr/psis/. (Assessed : 14th November 2021)
26. Saito T, Hama H, Suzuki K, 1995. Insecticide resistance in clones of the cotton aphid, Aphis gossypii Glover (Homoptera: Aphididae), and synergistic effect of esterase and mixed-function oxidase inhibitors. Jpn. J. Appl. Entomol. Zool. 39(2):151-158.
27. Sattelle DB, Cordova D, Cheek TR, 2008. Insect ryanodine receptors: molecular targets for novel pest control chemicals. Invertebr. Neurosci. 8(3):107.
28. Shi X, Jiang L, Wang H, Qiao K, Wang D, et al., 2011. Toxicities and sublethal effects of seven neonicotinoid insecticides on survival, growth and reproduction of imidacloprid‐resistant cotton aphid, Aphis gossypii. Pest Manag. Sci. 67(12):1528-1533.
29. Shim JY, Park JS, Paik WH, 1979. Studies on the life history of cotton aphid, Aphis gossypii Glover (Homoptera). Kor. J. Appl. Entomol. 18(2):85-88.
30. Wang K, Bai J, Zhao J, Su S, Liu L, et al., 2020. Super‐kdr mutation M918L and multiple cytochrome P450s associated with the resistance of Rhopalosiphum padi to pyrethroid. Pest Manag. Sci. 76(8):2809-2817.
31. Wu M, Gotoh H, Waters T, Walsh DB, Lavine LC, 2014. Identification of an alternative knockdown resistance (kdr)‐like mutation, M918L, and a novel mutation, V1010A, in the Thrips tabaci voltage‐gated sodium channel gene. Pest Manag. Sci. 70(6):977-981.
32. Yang H, Wang K, Wang H, Shi X, Niu F, 2009. Cross-resistance of the imidacloprid-resistant population of Aphis gossypii Glover (Homoptera: Aphididae) to pymetrozine and other three pesticides and the effects of pesticide application on its biological characteristics. Acta Entomol. Sinica 52(2):175-182.

Author Information and Contributions

Jong Min Lee, Department of Plant Medicine, Chungbuk National University, Master student, https://orcid.org/0000-0002-1340-5395

Jong Chan Jeon, Department of Plant Medicine, Chungbuk National University, Master student

Won Jin Kang, Department of Plant Medicine, Chungbuk National University, Ph.D. student

Hyun Kyung Kim, Department of Plant Medicine, Chungbuk National University, Visiting professor

Hyun-Na Koo, Department of Plant Medicine, Chungbuk National University, Visiting professor

Bueyong Park, Crop Protection Division, Department of Agro-Food Safety and Crop protection, National Institute of Agricultural Sciences, Researcher

Gil-Hah Kim, Department of Plant Medicine, Chungbuk National University, Professor, https://orcid.org/0000-0001-6256-8759

Conceptualization, Gil-Hah Kim; methodology, Jong Chan Jeon, Won Jin Kang and Bueyong Park; investigation, Jong Min Lee and, Jong Chan Jeon; data curation, Hyun-Na Koo and Hyun Kyung Kim; writing-original draft preparation, Jong Min Lee; writing-review and editing, Hyun-Na Koo, Hyun Kyung Kim, Bueyong Park and Gil-Hah Kim; supervision, Gil-Hah Kim