The Korean Society of Pesticide Science

Editorial Board

The Korean Journal of Pesticide Science - Vol. 27, No. 1

[ ORIGINAL ARTICLES ]
The Korean Journal of Pesticide Science - Vol. 27, No. 1, pp. 23-30
Abbreviation: Korean J. Pestic. Sci.
ISSN: 1226-6183 (Print) 2287-2051 (Online)
Print publication date 31 Mar 2023
Received 14 Jan 2023 Revised 10 Feb 2023 Accepted 10 Feb 2023
DOI: https://doi.org/10.7585/kjps.2023.27.1.23

Xenorhabdus hominickii 세균 이차대사물질의 대파 검은무늬병에 대한 방제 효과
진가현 ; 엠디따핌호사인흐리틱 ; 김용균*
안동대학교 식물의학과

Control Efficacy of Bacterial Secondary Metabolites of Xenorhabdus hominickii Against a Fungal Pathogen, Alternaria alternata, Infecting Welsh Onion
Gahyun Jin ; Md Tafim Hossain Hrithik ; Yonggyun Kim*
Department of Plant Medicals, College of Life Sciences, Andong National University, Andong 36729, Korea
Correspondence to : *E-mail: hosanna@anu.ac.kr

Funding Information ▼

초록

대파(Allium fistulosum)에 발생한 검은무늬병 병징 부위에서 새로운 병원체인 Alternaria alternata가 분리되었다. 기존에 이 병을 유발하는 것으로 알려진 A. porri와 비교하여 볼 때 분리된 균주의 분생포자 형태와 Internal Transcribed Spacer 염기서열에서 뚜렷한 차이를 나타냈다. 분리된 균주를 다시 재접종한 결과 대파에서 동일한 병징이 나타났다. 이 검은무늬병을 방제하기 위해 다양한 항생물질을 생산하는 Xenorhabdus hominickii 세균 배양액을 이용하였다. 에틸아세테이트 용매를 이용하여 배양액 추출물을 얻고 이를 처리한 결과 1,000 ppm 농도에서 뚜렷한 균사 성장 억제를 나타냈다. 특히 이 세균이 생산하는 세 가지 대사물질인 oxindole, bezylideneacetone 및 3-ethoxy-4-methoxyphenol을 각각 처리한 결과 100 ppm 이하의 낮은 농도에서도 뚜렷한 균사 성장 억제 효과를 나타냈다. 본 연구는 대파 검은무늬병을 일으키는 새로운 균주 A. alternata를 분리 동정하였으며, 이를 방제하기 위해 세균 대사체 유래 유용물질을 보고한다.

Abstract

A new pathogen, Alternaria alternata, was isolated from a welsh onion, Allium fistulosum, exhibiting leaf spot disease symptom. Compared to a previously known pathogen, A. porri, the isolate was different in spore structure and Internal Transcribed Spacer nucleotide sequence. When the isolate was reintroduced, the identical disease symptom was observed. To control this disease, an ethyl acetate extract of the bacterial culture broth of Xenorhabdus hominickii, which has been known to produce various secondary metabolites, was applied to the pathogen. It inhibited the mycelial growth at 1,000 ppm. At least three metabolites (oxindole, bezylideneacetone, and 3-ethoxy-4-methoxyphenol) identified from the bacterial culture broth showed the inhibitory activities at their doses less than 100 ppm against A. alternata growth. This study introduces a new pathogen on welsh onion and novel compounds derived from the bacteria to control the disease.


Keywords: Welsh onion, leaf spot disease, identification, control, secondary metabolite
키워드: 대파, 검은무늬병, 동정, 방제, 이차대사물질

서 론

대파(Allium fistulosum)는 한국, 일본, 중국 등 동아시아 지역에서 흔히 사용하는 양념 채소류이다(Sung, 2018). 대파 재배지역은 1960년대 이래 2000년까지 지속적으로 증가하여 90,627 ha에 이르렀으나 이후 감소하여 약 80,611 ha 규모에 이르고 있다(Statistics Korea, 2021). 이 경작지에서 연간 전체 355,931 톤이 생산되며 노지와 시설재배지 모두에서 경작되나 시설재배지는 아직 불과 약 14.3% (50,870톤)에 그치고 있다. 대파 작형은 4- 5월에 정식하여 9월 이후에 수확하는 춘파 재배와 9 - 10월에 정식하여 이듬해 3 - 4월에 수확하는 추파 재배로 구분되며 비교적 저온성 식물로 겨울 동안 비가온 상태의 시설재배지에서 생육할 수 있다(Nam et al., 2022).

대파에서 주로 발생하는 병해는 노균병(병원체: Peronospora destructor), 검은무늬병(병원체: Alternaria porri), 녹병(병원체: Puccinia allii), 잎마름병(병원체: Stemphylium vesicarium) 등으로 구성된다(NIAS, 2022). 노균병과 검은무늬병은 시설재배 시 병 발생도는 5% 미만으로 극히 낮으나 노지재배에서 장마 기간에 노균병은 20%, 검은무늬병은 25% 이상으로 발병률이 높지만, 잎마름병의 발병률은 비교적 낮은 경향을 보였다(Nam et al., 2022). 따라서 춘파 재배의 경우 대파 성숙기인 여름철에 이러한 병해가 심각하여 생산량에 크게 영향을 주게 된다. 검은무늬병은 대파 잎과 꽃대에 타원형 또는 방추형 담갈색 병반으로 나타나고, 이후 여러 겹무늬 대형 병반으로 확대된다(Mohsin et al., 2016). 때에 따라 자색의 겹무늬로 나타나기도 한다. 병반 중앙에는 검은 포자층이 밀생하여 검게 보이며, 심하면 잎 전체가 말라 죽게 한다.

본 연구는 대파 검은무늬병 증세를 보이는 대파 기주체에서 분리한 균주가 기존에 알려진 병원체와는 상이한 종으로 동정 되어 보고하게 되었다. 아울러 이 병원체의 성장을 억제하는 세균 유래 유용 대사물질의 검은무늬병 방제 효과를 검정하여 보고한다.


재료 및 방법
파검은무늬병 병원체 순수분리 및 배양

경상북도 안동시 용상동 대파 경작지(위도: 36.553298, 경도: 128.760648)에서 병반 주위가 회갈색으로 보이며 병반 중앙이 검은색으로 보이는 병징이 나타난 대파를 발견하였다. 이 대파의 병반 부위를 1% NaOCl을 이용하여 표면 살균한 후 멸균수를 이용하여 씻고 이를 Potato Dextrose Agar(PDA, Thermo Fisher Scientific, Waltham, MA, USA) 배지에 접종하여 28°C 인큐베이터에서 5일간 배양하였다.

파검은무늬병 병원체 동정

곰팡이를 동정하기 위하여 형태학적 동정과 분자생물학적 동정을 실시하였다. 형태학적 동정을 위하여 멸균수에 순수분리하여 배양한 후 3일간 4°C 냉장 보관한 곰팡이 균사체 일부를 이용하여 포자 현탁액을 만들었다. 이를 광학현미경을 이용하여 관찰하여 분생포자의 특징을 확인하였다. 분자생물학적 동정을 위하여 ITS 프라이머를 이용하여 염기서열 분석을 하였다. Chelex 100 (Bio-Rad, Hercules, CA, USA) 핵산 추출용액을 이용하여 곰팡이 게놈 DNA를 추출한 후 ITS1 (TCCGTAGGTGAACCTGCGG)과 ITS2 (GCTGCGTTCTTCATCGATGC) 프라이머(White et al., 1990)를 이용하여 다음 조건에서 ITS 영역을 35회 증폭하였다. 즉, 95°C에서 5분간 초기 변성과정 후 35회 증폭 주기를 갖는데 각 증폭 주기는 95°C 변성온도에서 30초, 50°C ITS 프라이머 결합온도에서 1분, 72°C 사슬연장 온도에서 1분으로 프로그램하여 진행되었다. 그 후 아가로즈젤(1%)에 전기영동하여 단일 밴드를 확인한 후 PCR 산물은 Expin PCE SV(GeneAll, Seoul, Korea)를 이용하여 프라이머와 잉여 반응물을 제거하였다. 정제된 PCR 산물은 양방향 염기서열 분석(Macrogen, Seoul, Korea)하여 GenBank (www.ncbi.nlmnih.gov)에 수록된 정보를 바탕으로 NCBI 검색엔진 BlastN을 이용하여 종 동정에 이용되었다.

Alternaria alternata ANU101 병원성 검증

대파에서 분리한 병원체가 대파에 대해 병원성을 가지는지 확인하기 위하여 병원성 검증을 실시하였다. 배양한 A.alternata ANU101으로 1.56×104 spores/mL 농도의 포자 현탁액을 만들었다. 이를 1% NaOCl을 이용하여 표면 살균한 후 세척한 대파에 10 μL씩 분주한 후 습실 처리하였다. 이후 대파 절편에 병징이 나타난 부위의 포자를 다시 현미경을 이용하여 관찰하여 접종한 포자 현탁액의 포자와 동일한 포자인지 확인하였다. 성장하는 대파 기주에 대한 병원성 검증은 포트에 어린 대파(약 20 cm 신장)를 심고 병원체가 배양된 PDA 배지를 지름 5 mm 원으로 잘라 대파 잎 부위에 치상한 후 25°C 인큐베이터에서 매일 병징을 확인하였다.

곤충병원세균 배양 및 이차대사산물 추출

두 곤충병원세균 균주인 Xenorhabdus hominickii ANU101(Park et al., 2017)과 X. hominickii DY1 (Mollah et al., 2020) 각각을 1 L 부피의tryptic soy broth (MB cell, Seoul, Korea) 배양액에서 배양하였다. 배양 조건은 28°C에서 48시간동안 회전진탕 배양하였다. 유기용매 추출액을 얻기 위해 배양액과 동일한 부피의 ethyl acetate를 첨가하고, 분리깔대기를 이용하여 유기용매층을 얻었다. 이를 다시 회전농축증발기(Ayala, NY, USA)를 이용하여 농축한 후 최종적으로 5mL의 메탄올로 수거하였다.

Alternaria alternata ANU101 병원균에 대한 세균대사물질 항균력 조사

곤충병원성 세균의 일종인 Xenorhabdus hominikii의 배양액 추출물과 세균 대사체 화합물인 benzylideneacetone (BZA), 3-ethoxy-4-methoxyphenol (EMP), oxindole을 PDA 배지에 첨가하여 페트리디쉬에 동일하게 각각 20mL씩 분주하였다. 세 종류의 화합물은 모두 Signal-Aldrich Korea (Seoul, Korea)에서 구입하였다. 배지의 중앙에 A. alternata ANU101이 배양된 PDA 배지를 지름 5mm 원형으로 잘라 접종하여 28°C 인큐베이터에서 7일간 배양하였다. 매일 배양된 곰팡이의 직경을 측정하여 각 물질을 함유하지 않은 PDA 배지에서 배양한 A. alternata ANU101의 직경과 비교하였다. 각 시험물질별로 농도 당 3 반복으로 조사하였다. 이를 바탕으로 대조군 대비 실험군의 억제능력을 측정하여 이를 토대로 중앙억제농도(IC50) 값을 Prism 9 (GraphPad Software, San Diego, CA, USA)를 이용하여 계산하였다.

타 식물병원균에 대한 세균대사물질 항균성

고추역병균(Phytophthora capsici), 고추탄저병균(Colletotrichum capsici), 고추시들음병균(Fusarium oxysporum)을 안동대학교 식물의학과 전용호 교수님 연구실에서 분양받았다. 곰팡이 배양과 항균력 검정은 상기의 방법을 따랐다.


결 과
대파 검은무늬병 분리 및 동정

안동지역에서 시설재배지에서 재배되는 대파에 발생한 검은무늬병을 관찰하였다. 대파 잎의 상층부에 주로 발생하였으며, 병이 진전됨에 따라 타원형의 검은 무늬 크기가 증가하였다. 병징이 나타난 대파 일부분을 PDA 배지에 올려놓고 병원균을 증식하였다. 분리한 병원균을 동정하기 위하여 형태학적 동정을 실시하였다. 형태학적 동정을 위하여 25°C 배양 온도에서 PDA 배지를 통해 배양한 병원균을 4°C에서 48시간 동안 방치한 후 분생포자를 형성하게 하였다(Fig. 1A). 균사는 격막 구조를 지니며 포자는 난형의 A. porri(Mohsin et al., 2016)와 달리 포탄 모양이었다(Fig. 1B).


Fig. 1. 
Isolation and identification of a fungal disease on welsh onion in a field. (A) A black ring spot symptom. (B) Spore structure of the fungal isolate. (C) Species prediction of the fungal isolate with its ITS sequence using Blast search program. (D) A phylogenetic analysis of ITS sequence of the fungal isolate with those of other Alternaria spp. ITS sequence Its blast search. Sequence alignment was performed with Clustal W program and the tree was constructed using MEGA9. Each node contains bootstrap value after 1,000 repetitions. GenBank accession numbers are MH854758.1 for CBS 106.24, OP482409.1 for WZ-605, KP124299.1 for CBS 104.26, OP482444.1 for ZW-S-17-1, OP482359 for HB-R-5, MF102105.1 for Pr.Ap1, KR811362.1 for ASU2, and JF331454.1 for CNU103012. Our isolate (A. alternata ANU101) was deposited to GenBank with accession number of OL468587.

분자생물학적 동정을 위해서 병원균의 DNA를 추출하여 ITS 프라이머를 이용하여 염기서열을 분석한 결과 Alternaria alternata ANU101로 동정하였다. 이 서열은 GenBank에 OL468587 번호로 등록되었다.

대파 병원균의 병원성 검증

동정한 병원균을 1.56 × 104 농도의 포자 현탁액을 만들어 1% NaOCl을 이용하여 표면 살균한 대파에 10 μL 씩 분주 한 후 습실 처리하였다. 2일 간격으로 병징을 관찰한 결과 5일 차부터 병징이 관찰되었다(Fig. 2). 즉, 이 결과는 분리된 균이 대파에 병원성이 있다는 것을 의미하였다. 병징이 나타난 부위의 포자를 다시 관찰한 결과 접종한 병원균의 포자와 동일한 포자라는 것을 확인하였다.


Fig. 2. 
Pathogenicity of the fungal isolate, A. alternata ANU101, against the welsh onion. (A) A laboratory test. A fungal inoculation used a damage method by scratching onion surface by 5 mm length with a sharp tip. The damage area was then pasted with 10 μL of a fungal suspension (1.56 × 104 spores/mL). Each treatment used 10 samples and replicated three times. Control represents the damage treatment without fungal inoculation. Different letters above standard deviation bars indicate significant difference among means at Type I error = 0.05. (B) Pot test. A fungal inoculation used a direct application of fungal colony (5 mm diameter) cultured on PDA on a young welsh onion (~20 cm height). The disease symptom was confirmed at 7 days after the inoculation. Control used the same size of PDA on the onion. White arrows indicate the disease symptom sites.

세균대사물질의 파검은무늬병 방제 효과

세균 유래의 대사체 3 종류(oxindole, EMP, BZA)를 PDA 배지에 첨가하여 페트리디쉬에 동일하게 각각 20mL씩 분주하였다. 배지의 중앙에 파검은무늬병균을 접종하여 28°C로 일주일간 배양하였다. 배양된 파검은무늬병균의 직경을 각 물질이 함유되지 않은 배지의 파검은무늬병균 직경과 비교하였다. 약제별로 농도당 3개의 페트리디쉬에 3 반복으로 조사하였다. 하루 간격으로 병원균의 지름을 측정하여 대조군 대비 실험군의 억제능력을 측정하였다. 이 결과 세균 대사체 모두 파검은무늬병균에 대해서 뚜렷한 항생 능력을 나타냈다(Fig. 3). 이 항생 능력의 결과를 토대로 X. hominikii ANU101의 IC50 값은 5,059 ppm이며 X. hominikii DY는 25,530 ppm, oxindole은 164.4 ppm, BZA는 194.9 ppm, EMP는 255.3 ppm 이다(Table 1).


Fig. 3. 
Anti-fungal activities of the bacterial metabolites of X. hominickii (Xh). For control culture, the A. alternata cultured in the PDA media was applied on 5 mm diameter disc in the center of each PDA medium and cultured at 28°C for 7 days. (A) Anti-fungal activities of two Xh culture broth (Xh-ANU101 and Xh-DY) against A. alternata. (B) Anti-fungal activities of three bacterial metabolites of oxindole, benzylideneacetone (BZA), and 3-ethoxy-4-methoxy phenol (EMP) against A. alternata. Control efficacy was calculated by the percent difference of fungal growth between treatment and control.

Table 1. 
Median inhibitory concentration (IC50) of secondary metabolites or culture broth of X. hominickii (Xh). Three metaboites include oxindole, benzylideneacetone (BZA), and 3-ethoxy-4-methoxy phenol (EMP). Two bacterial strains (Xh-ANU101 and Xh-DY) are used to get the culture broth
Secondary metabolites IC50 (95% CI), ppm df
Oxindole 164.4 (154.6~174.9) 9 0.9860
BZA 201.8 (134.3~285.1) 6 0.9748
EMP 255.3 (184.1~320.6) 6 0.9079
Xh-ANU101 5,059 (not assessed) 3 0.8832
Xh-DY 25,530 (not assessed) 3 0.9677

세균 대사물질의 타 식물병원 균에 대한 항균성

파검은무늬병균 이외의 다른 식물병원성 곰팡이에 대한 항균성을 가지는지 알아보기 위하여 실험은 진행하였다. 대사물질을 동일한 방법으로 1,000 ppm에서 고추역병균(Phytophthora capsici), 고추탄저병균(Colletotrichum capsici), 고추시들음병균(Fusarium oxysporum)에 대한 항균성을 조사한 결과 대부분 모두 높은 항균력을 나타냈으며, 이 가운데 BZA는 분석된 식물병원균 모두에 대해서 83% 이상의 균사성장 억제력을 나타냈다(Table 2).

Table 2. 
Antifungal activities of three bacterial metabolites derived from X. hominickii culture broth against the mycelial growth of three different phytopathogenic fungi
Compounds Control efficacy (%)
P. capsici C. acutatum F. oxysporum
Benzilideneacetone 85.8 ± 4.3 83.2 ± 0.3 88.4 ± 0.4
3-ethoxy-4-methoxyphenol 90.9 ± 0.0 73.1 ± 1.3 64.5 ± 0.4
Oxindole 90.4 ± 0.8 83.4 ± 0.7 70.9 ± 0.4


고 찰

본 연구에서는 기존에 대파 검은무늬병을 일으킨다고 잘 알려진 병원균인 A. porri 이외에 새로운 A. alternata 균주 역시 대파에 검은무늬병을 일으킨다는 것을 발견하였다. 식물 병원균으로서 A. alternata는 국내에서는 식량 작물이 벼를 비롯하여 채소류인 상추와 화훼류인 금어초 등 다양한 작물에 검은무늬병을 유발한다(Lee et al., 2022). 또한, 과채류인 참다래에서 이 식물병은 잎에 갈색 점무늬 증상을 유발하여 점차 짙은 갈색 둥근 무늬로 확대되면서 심할 때는 생육기 동안 낙엽을 초래하였다(Chung et al., 2008). A.alternata는 인도마호가니(Toona ciliate)라는 아열대 지역의 과수에서도 잎의 검은무늬병을 유발하는 것으로 보고되었다(Wang et al., 2023). 또한, 이 병원균은 국내에서 일명 해피트리로 알려져 실내에서 가꾸어지는 Heteropanax fragrans 관상용 수목 잎에 황색 반점을 유발하여 괴사를 유도하였다(Xie et al., 2022). 이러한 황색 반점 증상은 국내에서 재배되는 감자 잎에서도 발병되었다(Choi et al., 2022). 수확 후 대추 열매에 대해서 A. alternata가 검은무늬병을 유발한다고 보고되었다(Yuan et al., 2019). 이러한 A. alternaria에 의한 병 발생 기주를 고찰하면서 본 연구는 대파에도 이 병원균이 식물병을 유발한다는 것으로 최초로 보고한다.

검은무늬병균인 A. alternata는 과실류인 배에도 수확 후 검은무늬병을 일으키는데, 병 저항성 유도자인 acibenzolar-S-methyl (ASM)을 처리한 결과 병반의 크기가 줄어들었다(Guo et al., 2023a). 이는 ASM이 병 저항성 인자들인 phenylalanine ammonialyase 및 하위 phenylpropanoid 생합성 관련 효소들의 활성 및 이들의 유전자 발현을 증가시켜 페놀류, 플라보노이드, 안토시안닌 및 리그닌 등의 저항성 인자들을 증가시킨 결과로 해석된다. 최근 A. alternata 성장억제를 유발하는 항균물질이 Bacillus altitudinis Q7 세균 균주에서 보고되었다(Guo et al., 2023b). 이 보고에 의하면 이 균주에서 9개 아미노산이 고리형 골격을 이루는 lichenysin 물질이 A. alternata의 세포막 물질 흐름을 교란하여 세포질단백질 및 핵산이 유출되게 하여 항균 활성을 보였다.

유용 세균으로부터 유래된 이차 대사체를 이용하여 식물병 방제에 적용한다는 측면에서 다양한 이차대사산물을 생산하는 세균류 가운데 Xenorhabdus/Photorhabdus가 포함된다. 최근 이들 45종 세균의 전장서열을 바탕으로 이차대사산물 발현 유전체가 분석되어 총 1,000개의 Biosynthetic Gene Cluster (BGC)가 동정 되었으며, 이 BGC는 총 147개 이차대사산물을 생산하는 데 관여하는 것으로 추정하였다(Shi et al., 2022). 이들 대사체는 페닐에틸아마이드(phenylethylamide)와 같은 단순 구조물에서 heterocyclic 구조의 비교적 복잡한 물질까지 망라하였으며 이들 물질이 항생 능력을 보유하는 것으로 판명되었다(Tobias et al., 2018; Hasan et al., 2019). 본 연구에서는 이들 세균류 가운데 X.hominickii를 이용하며 이 세균이 최소 3가지의 대사물질(oxindole, benzylideneacetone (BZA), 3-ethoxy-4-methoxyphenol)을 생산하는 데(Mollah and Kim, 2020), 이들 물질이 A. alternata 성장을 억제하는 항생 능력을 갖는다고 밝혔다. 따라서 X. hominickii 세균 배양액으로도 병 억제가 가능하다는 것을 뒷받침하였다. 이러한 항생 능력은 또 다른 식물 병원균들인 고추역병균, 고추탄저병원균, 고추시들음병원균에서 나타났다. 실제로 BZA는 탄저병 및 역병에 대한 방제 능력을 기존에 보고한 바 있다(Park et al., 2010). 한편 대파 검은무늬병을 유발하는 A. porri에 대한 유효한 항진균물질이 녹나무과에 속한 Caryodaphnopsis baviensis에서 추출되었으며, 이 물질에서 magnolol이 분리되었다(Kim et al., 2022). 흥미롭게도 magnolol은 마치 BZA 이량체 구조와 유사하여 이들 구조가 항진균효과에 유효하다는 것을 제시하였다. BZA를 골격으로 하는 물질들을 스크리닝하면 우수한 항진균물질을 확보할 수 있을 것으로 사료된다.

이상의 결과를 정리하면, 대파에 발생하는 검은무늬병은 기존의 A. porri에 더불어 A. alternaria가 주요 병원균이라는 것을 본 연구를 통해 보고한다. 아울러 이 식물병은 X.hominickii의 대사체에 의해 방제가 가능한 생물적 방제 기술도 아울러 보고한다.


Acknowledgments

본 결과물은 농림축산식품부의 재원으로 농림식품기술기획평가원의 작물바이러스 및 병해충대응 산업화 기술개발사업의 지원(321100-3)을 받아 연구되었습니다.

이해상충관계

저자는 이해상충관계가 없음을 선언합니다.


References
1. Choi J, Jeong MH, Choi ED, Park J, Park SY, 2022. First report of brown spot caused by Alternaria alternata on potato (Solanum tuberosom L.) in Korea. Plant Dis.
2. Jeong IH, Kim GH, Lim MT, Hur JS, Shin JS, et al., 2008. Brown ring spot on leaves of kiwifruit caused by Alternaria alternata. Plant Dis. Res. 14(1):68-70.
3. Deng Q, Lei X, Zhang H, Deng L, Yi L, et al., 2022. Phenylalanine promotes biofilm formation of Meyerozyma caribbica to improve biocontrol efficacy against jujube black spot rot. J. Fungi 8(12):1313.
4. Guo Y, Li X, Li C, Jinyue R, Xu H, et al., 2023a. Acibenzolar-S-methyl activates phenylpropanoid pathway to enhance resistance against Alternaria alternata in pear fruit. J. Sci. Food Agric. 103(2):829-836.
5. Guo P, Yang F, Ye S, Li J, Shen F, et al., 2023b. Characterization of lipopeptide produced by Bacillus altitudinis Q7 and inhibitory effect on Alternaria alternata. J. Basic Microbiol. 63(1):26-38.
6. Hasan A, Yeom HS, Ryu J, Bode HB, Kim Y., 2019. Phenylethylamides derived from bacterial secondary metabolites specifically inhibit an insect serotonin receptor. Sci. Rep. 9, 20358.
7. Kim MY, Han JW, Dang QL, Kim JC, Kim H, et al., 2022. Characterization of Alternaria porri causing onion purple blotch and its antifungal compound magnolol identified from Caryodaphnopsis baviensis. PLoS ONE 17:e0262836.
8. Lee KH, Shin JH, Lee NH, Lee UJ, Kim KS, 2022. Effects of plant extracts and the antagonistic microbe Bacillus velezensis UK1 on mycelial growth of the lettuce leaf spot pathogen Alternaria alternata KL-1. J. Agric. Life Environ. Sci.
9. Mohsin SM, Islam MR, Ahmmed ANF, Nishai HAC, Hasanuzzaman M. 2016. Cultural, morphological and pathogenic characterization of Alternaria porri causing purple blotch of onion. Not. Bot. Horti. Agrobo. 44(1):222-227.
10. Mollah MMI, Kim Y, 2020. Virulent secondary metabolites of entomopathogenic bacteria genera, Xenorhabdus and Photorhabdus, inhibit phospholipase A2 to suppress host insect immunity. BMC Microbiol. 20:359.
11. Mollah MMI, Roy MC, Choi DY, Hasan MA, Al Baki MA, et al., 2020. Variations of indole metabolites and NRPS-PKS loci in two different virulent strains of Xenorhabdus hominickii. Front. Microbiol. 11:583594.
12. Nam J, Im S, Jang J, Shin M, Moon J, et al., 2022, Test of the characteristics of occurrence of major pathogens on green onions in Gyeonggi-Do and the effect of organic agricultural materials for eco-friendly control. Proceedings of Society of Korean Environmental Agriculture. pp. 237-238.
13. NIAS (National Institute of Agricultural Sciences). 2022. List of plant pathogens in Korea. http://genebank.rda.go.kr/kplantdisease.do. Accessed at December 12, 2022.
14. Park SJ, Jun MH, Chun WS, Seo JA, Yi YK, et al., 2010. Control effects of benzylideneacetone isolated from Xenorabdus nematophilla K1 on the diseases of red pepper plants. Plant Dis. Res. 16(2):170-175.
15. Park Y, Kang S, Sadekuzzaman M, Kim H, Jung JK, et al., 2017. Identification and bacterial characteristics of Xenorhabdus hominickii ANU101 from an entomopathogenic nematode, Steinernema monticolum. J. Invertebr. Pathol. 144:74-87.
16. Shi YM, Hirschmann M, Shi YN, Ahmed S, Abebew D, et al., 2022. Global analysis of biosynthetic gene clusters reveals conserved and unique natural products in entomopathogenic nematode-symbiotic bacteria. Nat. Chem. 14:701-712.
17. Statistics Korea, 2021. Agriculture, fishery & forestry census. https://kostat.go.kr/portal/korea/kor_nw/1/8/8/index.board. (accessed at December 12, 2022)
18. Sung YY, Kim DS, Kim SH, Kim HK, 2018. Aqueous and ethanolic extracts of welsh onion, Allium fistulosum, attenuate high-fat diet-induced obesity. BMC Complement Altern. Med. 18:105.
19. Tobias NJ, Shi YM, Bode HB, 2018. Refining the natural product repertoire in entomopathogenic bacteria. Trends Microbiol. 26:833-840.
20. Wang Y, Ye R, Lu S, Lv B, Zhang Y, 2023. First report of Alternaria alternata causing leaf spot on Toona ciliate in China. Plant Dis.
21. White TJ, Bruns T, Lee S, Taylor J, 1990. Amplification and direct sequencing of fungi ribosomal RNA genes for phylogenetics. In: PCR protocols: A guide to methods and applications. pp. 515-322. Academic Press, NY, USA.
22. Xie Z, Liu YL, Luo JQ, Lian SW, Cheng PY, et al., 2022. First report of Alternaria alternata causing leaf yellow spot on Heteropanax fragrans in China. Plant Dis.
23. Yuan S, Yan J, Wang M, Ding X, Zhang Y, et al., 2019. Transcriptomic and metabolic profiling reveals ‘green ring’ and ‘red ring’ on jujube fruit upon postharvest Alternaria alternata infection. Plant Cell Physiol. 60(4):844-861.

Author Information and Contributions

Gahyun Jin: Andong National University, Bioassay, Data analysis, Draft writing

Md Tafim Hossain Hrithrik: Andong National University, Fungal isolation, Data analysis

Yonggyun Kim: Andong National University, Manuscript writing and review, Project administration, https://orcid.org/0000-0002-6840-2167