The Korean Society of Pesticide Science

Editorial Board

The Korean Journal of Pesticide Science - Vol. 27, No. 4

[ ORIGINAL ARTICLES ]
The Korean Journal of Pesticide Science - Vol. 27, No. 4, pp. 303-310
Abbreviation: Korean J. Pestic. Sci.
ISSN: 1226-6183 (Print) 2287-2051 (Online)
Print publication date 30 Dec 2023
Received 20 Sep 2023 Revised 05 Nov 2023 Accepted 07 Nov 2023
DOI: https://doi.org/10.7585/kjps.2023.27.4.303

국내 배추무름병균과 배추검은썩음병균의 스트렙토마이신 저항성 조사
이미현 ; 고형래 ; 이용환 ; 홍성기 ; 최효원1, *
농촌진흥청 국립농업과학원 작물보호과
1농촌친흥청 재해대응과

Investigation of Streptomycin Resistance of Pectobacterium spp. and Xanthomonas campestris pv. campestris Isolated from Kimchi Cabbage in Korea
Mi-Hyun Lee ; Hyoung-Rai Ko ; Yong Hwan Lee ; Sung Kee Hong ; Hyo-Won Choi1, *
Crop Protection Division, National Institute of Agricultural Sciences, Wanju 55365, Republic of Korea
1Disaster Management Division, Rural Development Administration, Jeonju 54875, Republic of Korea
Correspondence to : *E-mail: hyon338@korea.kr

Funding Information ▼

초록

배추는 한국의 5대 채소작물 중 하나로 중요한 작물이다. 배추에서는 세균에 의한 무름병과 검은썩음병 등에 의한 피해가 알려져 있으며 배추, 무 등에서 분리한 무름병균의 스트렙토마이신 저항성균의 발생이 이미 알려져 있다. 2020년과 2021년 태백, 해남, 괴산, 완주, 김제에서 배추 무름증상과 검은썩음병의 병징을 보이는 시료를 수집하여 19개의 무름병균과 4개의 검은썩음병균을 분리하였다. 이들 균주의 스트렙토마이신 저항성 반응을 검정한 결과, 괴산에서 분리한 검은썩음병균에서 스트렙토마이신 저항성을 확인하였다. 스트렙토마이신 저항성 검은썩음병균(XccSmR)은 rpsL 유전자 88번 염기의 변이에 의해 아미노산 라이신(AAG)이 아르기닌(AGG)으로 치환되었다. 저항성균주(XccSmR)의 스트렙토마이신 최소억제농도를 검정한 결과 2,500 μg/ml 이상인 것으로 나타났다. 배추 재배지에서 무름병 방제를 위해 스트렙토마이신 등의 약제 살포가 빈번히 이루어진 것이 저항성균이 출현한 원인으로 생각되며, 향후 여러 지역과 포장에서 검은썩음병균을 분리하여 저항성을 모니터링할 필요가 있다.

Abstract

Kimchi cabbage is an important crop as one of the five major vegetable crops in Korea. It is reported that soft rot and black rot caused by Pectobacterium sp. and Xanthomonas campestris pv. campestris known in kimchi cabbage. In 2020 and 2021, samples showing symptoms of soft rot and black rot were collected from Taebaek, Haenam, Goesan, Wanju, and Gimje in Kimchi cabbage, and Pectobacterium sp. and X. campestris pv. campestris were isolated 19 and 4, respectively. Isolates of Pectobacterium sp. and X. campestris pv. campestris were screened for streptomycin resistance, with one from an field in Goesan showing resistance at 100 μg/ml streptomycin. X. campestris pv. campestris streptomycin-resistant SmR (XccSmR) occurs a point mutation that altered codon lysine (AAA) to arginine (AGG) of the ribosomal rpsL gene, containing codon 88. To assess the levels of streptomycin resistance, XccSmR showed resistance to streptomycin at levels 2,500 μg/ml. Identification of streptomycin-resistant strains is important to prevent the emergence of resistant populations. Thus, isolation of X. campestris pv. campestris from various kimchi cabbage-growing regions and resistance monitoring are needed to reduce the spread of streptomycin resistance strains.


Keywords: kimchi cabbage, Pectobacterium sp., Xanthomonas campestris pv. campestris, streptomycin resistance
키워드: 배추, 무름병균, 검은썩음병균, 스트렙토마이신 저항성

서 론

배추는 한국의 5대 채소작물 중 하나로 매우 중요한 작물이다. 한국식물병명목록에 의하면 국내 배추에 발생하는 병은 33종이 보고되어 있으며, 특히 세균에 의한 무름병과 검은썩음병 등의 피해가 잘 알려져 있다(The Korean Society of Plant Pahthology, 2022). 무름병균은 Pectobacterium속의 병원균으로 지제부와 잎에 무름증상을 나타내고, 특유의 냄새가 나서 다른 병과 구분이 가능하다. Pectobacterium속 내 16종이 감자, 배추, 무 등에서 병원성을 가지며, 국내 배추에서는 P. carotovorum, P. brasiliense, P. odoriferum, P. aroidearum, P. versatile이 병을 일으키는 것으로 보고 되었다(Lee et al., 2014; Park et al., 1999; Roh et al., 2009; Seo et al., 2004; Jee et al., 2020). 검은썩음병균은 Xanthomonas속의 병원균으로 배추, 양배추, 콜라비, 무 등 배추과 작물에 발생하며 잎 조직에 검은색의 병반을 만들며, 심하면 줄기까지 침입하는 것으로 알려져 있다(Velasco et al., 2013; Chan and Goodwin 1999; Vicente and Holub 2013). 또한 검은썩음병의 병반은 무름병을 일으키는 Pectobacterium속균과 부패병을 일으키는 Pseudomonas속균과 같은 다른 병원균이 쉽게 침투할 수 있게 되어 무름 증상이 동반되기도 한다(Williams 1980; Cook et al., 1952).

국내의 경우, 배추 무름병 방제를 위해 옥솔린산, 스트렙토마이신, 옥시테트라싸이클린, 가스가마이신 등 항생제 8개의 유효성분에 대해 단제 47개 품목, 합제 27개 품목이 농촌진흥청 농약안전정보시스템에 등록되어있다(Rural Development Administration Regulation of pesticide toxicity). 한편 인도, 케냐 등에서는 양배추의 검은썩음병 방제를 위해 스트렙토마이신, 옥시테트라싸이클린, 동제 등을 이용한 방제 연구가 수행되었고(Knosel 1965; Bhat et al., 2000), 우리나라에도 양배추에는 여러 약제가 등록되어 있으나 배추 검은썩음병에는 등록된 약제가 없는 실정이다.

항생제는 1950년 대부터 인간의 세균병 치료를 위해 사용되었으며 식물 세균병 방제를 위한 농업용 스트렙토마이신은 벼에서 처음 사용되기 시작하였다(Sundin and Bender 1993, Yong et al., 2004). 전세계적으로 스트렙토마이신을 연속해서 사용함에 따라 최근 Erwinia amylovora, Pseudomonas syringae, Xanthomonas oryzae pv. oryzae 등에서 저항성균이 보고되었다(Scheck et al., 1996; Xu et al., 2013; Sundin and Wang 2018). 스트렙토마이신 저항성 기작은 게놈 내 30S 리보좀의 S12 단백질을 코딩하는 rpsL 유전자의 단일염기 변이와 플라스미드 내 strAstrB 유전자의 삽입에 의한 저항성 발현 등 2가지가 알려져 있다(Sundin and Bender 1993, Chiou and Jones 1995). 국내 식물병원 세균에 대한 항생제 저항성 연구 보고는 많지 않으나 최근에는 Pectobacterium sp.에 의한 무름병, P. syringe pv. actinidiae에 의한 참다래 궤양병 및 E. pyrifoliae에 의한 사과 가지검은마름병에서 스트렙토마이신 저항성이 보고되었다(Lee et al., 2020; Kim et al., 2021; Lee et al., 2023). 본 연구에서는 고랭지 배추 재배지인 태백, 월동배추 재배지 해남, 가을 배추 재배지 괴산 등에서 분리한 배추 무름병균과 검은썩음병균을 동정하고, 국내 배추 무름병 약제로 사용되고 있는 스트렙토마이신을 대상으로 저항성 정도를 조사하였으며, 유전자 변이 분석을 수행하여 저항성 기작을 구명하였다.


재료 및 방법
병원균 분리

2021년과 2022년 태백, 괴산 등 배추 재배지에서 무름증상과 검은썩음병의 병징이 보이는 시료를 수집한 GPS 정보는 Table 1과 같다. 병원균을 분리하기 위하여 이병시료를 흐르는 수돗물로 세척한 후 물기를 제거하고, 이병부위의 시료를 채취하여 1% 차아염소산나트륨 70% 에탄올로 표면을 소독한 후, 멸균수로 세척하였다. 표면소독 한 시료에서 물기를 제거한 후 500 μl 멸균수와 비즈가 담긴 튜브에 넣고 30분간 방치하였다. Taco Prep Bead Beater (GeneReach, Taiwan)를 이용하여 마쇄한 후 마쇄액 10 μl를 이용하여 Tryptic soy agar (TSA, Difco)에 획선 도말한 후, 25oC에 배양하였고, 단일 균총을 취하여 균을 순수분리 하였다. 또한 실험에 활용하기 위한 대조균주로서 배추무름병균 P. carotovorum 2균주(KACC 18645, KACC 22674), P. brasiliense 2균주(KACC 22675, KACC 22678), P. odorifeum 1균주(KACC 22680), P. versatile 1균주(KACC 22669), 검은썩음병균 Xanthomonas campestris pv. campestris 6균주(KACC 10377, KACC 17966, KACC 19132, KACC 19135, KACC 19136), Xanthomonas속 2종 2균주(KACC 14864, KACC 11139)를 국립농업과학원 농업미생물은행(KACC)에서 분양 받았다.

Table 1. 
GPS information on the fields from which the sample was collected
No. Strain City GPS
1 MHPb01 Wanju 35.825531, 127.044364
2 MHPecto2101 Taebaek 37.324627, 128.971006
3 MHPecto2102 Taebaek 37.327345, 128.968922
4 MHPecto2103 Taebaek 37.277156, 128.991127
5 MHPecto2104 Taebaek 37.280820, 128.988684
6 MHPecto2105 Taebaek 37.268358, 128.953900
7 MHPecto2106 Gimje 35.853265, 126.903521
8 MHPecto2107 Gimje 35.853656, 126.912609
9 MHPecto2108 Gimje 35.853400, 126.904200
10 MHPecto2109 Gimje 35.853100, 126.904300
11 MHPecto2110 Haenam 34.376194, 126.614083
12 MHPecto2111 Haenam 34.377533, 126.616486
13 MHPecto2112 Haenam 34.377418, 126.618890
14 MHPecto2113 Haenam 34.377328, 126.606497
15 MHPecto2114 Haenam 34.390627, 126.607624
16 MHPecto2201 Taebaek 37.217939, 128.967567
17 MHPecto2202 Taebaek 37.215344, 128.970909
18 MHPecto2203 Goesan 36.8485731,127.745617
19 MHPecto2204 Goesan 36.788083, 127.794183
20 MHXcc2101 Taebaek 37.217806, 128.967611
21 MHXcc2201 Goesan 36.848573, 127.745617
22 MHXcc2202 Goesan 36.788083, 127.794183
23 MHXcc2203 Goesan 36.701441, 127.724629

Table 2. 
Survey information for the field where streptomycin-resistant (SmR) Pectobacterium sp. and Xanthomonas sp. was detected
No. Strain Identification Year City SmR Codon 88
of rpsL
1 KACC 18645 P. carotovorum 2014 Jeongseon - -
2 KACC 22674 P. carotovorum - Jeongseon - -
3 KACC 22675 P. brasiliense - Pyeongchang - -
4 KACC 22678 P. brasiliense - Hongcheon - -
5 KACC22680 P. odoriferum - Gangneung - -
6 KACC22669 P. versatile - Gangneung - -
7 MHPb01 P. brasiliense 2021 Wanju - -
8 MHPecto2101 Pectobacterium sp. 2021 Taebaek - -
9 MHPecto2102 Pectobacterium sp. 2021 Taebaek - -
10 MHPecto2103 P. carotovorum 2021 Taebaek - -
11 MHPecto2104 Pectobacterium sp. 2021 Taebaek - -
12 MHPecto2105 Pectobacterium sp. 2021 Taebaek - -
13 MHPecto2106 P. carotovorum 2021 Gimje - -
14 MHPecto2107 P. carotovorum 2021 Gimje - -
15 MHPecto2108 P. carotovorum 2021 Gimje - -
16 MHPecto2109 P. carotovorum 2021 Gimje - -
17 MHPecto2110 P. carotovorum 2021 Haenam - -
18 MHPecto2111 P. carotovorum 2021 Haenam - -
19 MHPecto2112 P. carotovorum 2021 Haenam - -
20 MHPecto2113 P. brasiliense 2021 Haenam - -
21 MHPecto2114 P. brasiliense 2021 Haenam - -
22 MHPecto2201 P. carotovorum 2022 Taebaek - -
23 MHPecto2202 P. carotovorum 2022 Taebaek - -
24 MHPecto2203 P. brasiliense 2022 Goesan - -
25 MHPecto2204 P. brasiliense 2022 Goesan - -
26 MHXcc2101 X. campestris pv. campestris 2021 Taebaek + AGG
27 MHXcc2201 X. campestris pv. campestris 2022 Goesan - -
28 MHXcc2202 X. campestris pv. campestris 2022 Goesan - -
29 MHXcc2203 X. campestris pv. campestris 2022 Goesan - -
30 KACC 10377 X. campestris pv. campestris - - - -
31 KACC 17966 X. campestris pv. campestris - Gangneung - -
32 KACC 19132 X. campestris pv. campestris 2013 Pyeongchang - -
33 KACC 19133 X. campestris pv. campestris 2013 Gangneung - -
34 KACC 19135 X. campestris pv. campestris 2013 Samcheok - -
35 KACC 19136 X. campestris pv. campestris 2013 Taebaek - -
36 KACC 14864 Xanthomonas sp. - - - -
37 KACC 11139 Xanthomonas sp. 1999 Cheonan - -
* SmR : streptomycin-resistant

병원균 동정

병원균을 동정하기 위하여 순수분리한 23개의 균주로부터 DNA 추출 키트(Plant DNA extraction kit, Qiagen)를 사용하여 DNA를 분리하였다. 무름병균의 정확한 동정을 위한 mutilocus sequencing analysis (MLSA)를 실시하기 위해 Aconitate hydrase1 (acnA), Glyceraldehyde-3-phosphate dehydrogenase A (gapA), Isocitrate dehydrogenase, specific for NADP+ (icdA), Malate dehydrogenase (mdh), Mannitol-1-phosphate dehydrogenase (mtlD), Glucose-6-phosphate isomerase (pgi), Gamma-glutamylphosphate reductase (proA) 유전자의 염기서열을 확보하였다(Ma et al., 2007). 각 유전자 증폭은 Table 3의 프라이머를 이용하였고 PCR 조건은 Ma et al. (2007)에 기술된 방법에 따라 실시하였다. 7개의 유전자의 염기서열을 순서대로 붙여 총 3,118 bp의 서열을 대상으로 계통수를 작성하였다. 검은썩음병균은 16S rRNA를 518F (5'-CCAGCAGCCGCGGTAATACG-3'), 800R (5'-TACCAGGGTATCTAATCC-3') 프라이머를 이용하여 PCR을 실시하고 염기서열을 확보하였다(Sanko et al., 2018). 확보된 염기서열을 이용하여 MEGA version 7.0.26에서 Maximum Likelihood Tree로 Bootstrap 횟수를 1,000반복으로 설정하고 Juke-Cantor model로 선택하여 계통수를 작성하였다.

Table 3. 
Primers developed for MLSA of Pectobacterium sp.
Target Primer Primer sequence (5’–3’) Amplicon
length (bp)
acnA acnA3F CMA GRG TRT TRA TGC ARG AYT TTA C 288
(Aconitate hydrase1) acnA3R GAT CAT GGT GGT RTG SGA RTC VGT
gapA gapA326F ATC TTC CTG ACC GAC GAA ACT GC 407
(Glyceraldehyde-3-phosphate dehydrogenase A) gapA845R ACG TCA TCT TCG GTG TAA CCC AG
icdA icdA400F GGT GGT ATC CGT TCT CTG AAC G 479
(Isocitrate dehydrogenase, specific for NADP+) icdA977R TAG TCG CCG TTC AGG TTC ATA CA 438
mdh mdh86F CCC AGC TTC CTT CAG GTT CAG A
(Malate dehydrogenase) mdh628R CTG CAT TCT GAA TAC GTT TGG TCA
mtlD mtlD146F GGC CGG TAA TAT CGG CCG TGG 395
(Mannitol-1-phosphate dehydrogenase) mtlD650R CAT TCG CTG AAG GTT TCC ACC GT
mtIDF CTG YTG GAT GCI CTS AAC MGY CG
mltDR TCC ACR GCR GAA TCW ACR AAT CC
pgi pgi815F TGG GTC GGC GGC CGT TAC TC 495
(Glucose-6-phosphate isomerase) pgi1396R TGC CTT CGA ATA CTT TGA ACG GC
pgiF2 CTG TCY ACC AAT GCS AAA GCC G
pgiR2 CAG CAG GAT GGA GTT GGT CGG
pgiF TCT YTI GGI TTT GAK AAY TTT GA
pgiR YGC CGC YGI AAA TTC IGC TTC
proA proAF1 CGG YAA TGC GGT GAT TCT GCG 616
(Gamma-glutamylphosphate reductase) proAR1 GGG TAC TGA CCG CCA CTT C

스트렙토마이신 저항성 검정

병원균의 스트렙토마이신 저항성 검정을 위하여 TSA 배지에 스트렙토마이신 100 μg/ml을 첨가하여 제조하였다. 수집한 균주는 스트렙토마이신 100 μg/ml이 첨가된 배지에 평판 도말하여 저항성 균주를 선발하였고, 농업미생물은행에서 분양받은 균주는 획선도말하여 저항성 여부를 검정하였다.

스트렙토마이신 저항성 관련 유전자 검정 및 rpsL 유전자 변이 조사

총 23개 균주를 대상으로 스트렙토마이신 저항성을 검정한 결과, 괴산에서 분리된 MHXcc2101 1개 균주가 저항성인 것으로 나타났다. 이 균주의 저항성 발현기작을 분석하기 위해 DNA 추출 키트(Plant DNA extraction kit, Qiagen)를 사용하여 DNA를 분리하였다. strAstrB 유전자와 rpsL 유전자 부위의 염기서열 변이를 분석하기 위하여 Table 4의 프라이머를 이용하여 PCR 증폭하였고, PCR 조건은 Sharma et al. (2022)에 기술된 방법에 따라 실시하였다. PCR 산물 5 μl를 1% 아가로스겔에 로딩하여 PCR 증폭산물을 확인하였다.

Table 4. 
Primers developed for polymerase chain reaction
Target Primer Primer sequence (5'–3') Amplicon length (bp)
strA strA-F CCAAGTCAGAGGGTCCAATC 760
strA-R TGACTGGTTGCCTGTCAGAG
strB strB-F TAGATCGCGTTGCTCCTCTT 758
strB-R ACGTTTCGCAACCTGTTCTC
rpsL rpsL-F CAAGCGACCACCTACAAGAGT 315
rpsL-R GTACTTGGAACGGCCTTGAC

스트렙토마이신 저항성 균주의 항생제 반응 검정

TSA에 배양된 스트렙토마이신 저항성 균주의 균총을 멸균수 5ml에 현탁하여 OD600을 0.1로 조정한 세균 현탁액 100 μl를 취하여 TSA 배지에 평판 도말하였다. 평판 도말한 배지에 스트렙토마이신(0.064~1,024 μg/ml)이 농도별로 처리된 E-test (Biomerieux) 스트립을 배지에 올려놓고 28oC에서 24시간 배양하였다. 대조균으로 스트렙토마이신 감수성 균주인 X. campestris pv. campestris (KACC 10377)과 비교하였다. 또한 저항성 균주의 최소억제농도(MIC, minimal inhibition concentration)를 확인하기 위하여 저항성 균주를 평판 도말한 후 스트렙토마이신 0, 1, 5, 100, 500, 1,000, 2,500 μg/ml 농도를 8 mm paper disc (Toyo Roshi, Japan)에 올려 스트렙토마이신 반응을 조사하였다.


결과 및 고찰
병원균 동정

태백, 해남, 괴산, 완주, 김제에서 수집한 이병시료에서 병원균을 분리한 결과, 총 19개의 Pectobacterium균과 4개의 Xanthomonas균이 분리되었다. Pectobacterium균은 Brenneria속과 Dickeya속을 포함하여 MLSA 분석과 계통수 작성을 통해 P. carotovorum, P. brasiliense 2종으로 동정하였다(Fig. 1). 대표균주 P. carotovorum 1종(GenBank: LC782010)과 P. brasiliense 2종(GenBank: LC645699, LC685064)의 16S rRNA 염기서열을 NCBI 데이터베이스에 등록하였다. Pectobacterium속은 Brenneria속, Dickeya속과 계통적으로 거리가 멀고, 종 단위로 그룹핑되는 것을 확인할 수 있다(Fig. 1). Jee et al. (2020) 등에 의하면 국내 배추재배지에서는 5종이 병을 일으키는 것으로 알려져 있으나 이번 조사에서 분리한 균주에서는 P. odoriferum, P. aroidearum, P. versatile는 분리되지 않았다. 고랭지 지역인 태백에서 분리한 균주는 모두 P. carotovorum이였으며 해남 지역에서는 P. carotovorumP. brasiliense 두 종이 함께 분리되었다. 시료 수집 연도가 짧고 균주 수가 많지 않아 지역별 우점 병원균은 명확하지 않으나 지속적인 조사가 이루어진다면 지역별 우점종을 알 수 있을 것으로 사료된다. 태백, 괴산지역에서 분리한 검은썩음병균 4개 균주는 16S rRNA 염기서열 분석을 통해 계통수를 작성한 결과 Xanthomonas campestris pv. campestris로 동정되었다(Fig. 2). 채집 당시 시료는 병반 부위에 무름병 등의 2차 감염은 없었으며 병원균 분리 시 검은썩음병 이외의 병원균은 분리되지 않았다. 분리한 균주를 배추 유묘에 접종한 결과, 모두 병원성이 있는 것으로 확인되었다(데이터 미제시). 국내의 경우, 배추 검은썩음병에 대한 연구가 매우 적어 발생현황, 병원균의 특성 등에 대한 연구가 미진하다.


Fig. 1. 
Phylogenetic analysis of Pectobacterium strains based on sequences of acnA, gapA, icdA, mdh, mtlD, pgi, and proA. DNA sequences sourced from the NCBI database were aligned using ClustalW and phylogenetic trees were constructed and visualized using the maximum likelihood and MEGA7, respectively.


Fig. 2. 
Phylogenetic analysis of Xanthomonas campestris pv. campestris and Xanthomonas spp. based on sequences of 16S rRNA. DNA sequences sourced from the NCBI database were aligned using ClustalW and phylogenetic trees were constructed and visualized using the maximum likelihood and MEGA7, respectively.

스트렙토마이신 저항성 검정

무름병균과 검은썩음병균의 스트렙토마이신 저항성을 검정한 결과, 무름병균에서는 저항성을 갖는 균주가 분리되지 않았으나 괴산에서 분리한 검은썩음병균(XCCSmR) 1균주가 스트렙토마이신 저항성인 것으로 확인되었다(Table 2). 대조균으로 사용된 국립농업과학원 농업미생물은행(KACC) 균주는 모두 스트렙토마이신 감수성으로 확인되었다. 저항성을 나타낸 검은썩음병균(XCCSmR)을 스트렙토마이신이 농도별로 코팅되어 있는 E-test 스트립 테스트를 한 결과, 감수성 균주인 KACC10377는 최소억제농도가 3 μg/ml 인 것에 비해 저항성 균주는 1,024 μg/ml에서도 저지환이 형성되지 않아 스트렙토마이신에 저항성임을 다시 확인하였다(Fig. 3C). 저항성 균주(XCCSmR)를 배추 유묘 5주에 3반복으로 접종한 결과, 감수성 균주와 비교하여 병원성에 차이는 없는 것으로 나타났다(Fig. 3B).


Fig. 3. 
A, Polymerase chain reaction (PCR) detection of the rpsL and strA and strB. Lane M: 1-kb ladder. N: Negative control. S: XCCSmR; B, Pathogenicity assay in kimchi cabbage inoculated with KACC10377 and XccSmR. KACC10377 and XccSmR produced similar symptoms in kimchi cabbage at 14 days postinoculation. C-D, Inhibitory effect of streptomycin on the growth of KACC10377 and XCCSmR, assessed using the E-test strip (C) and the paper-disc method (D). Streptomycin concentration: 0 - 2,500 μg/ml.

본 연구에서 수집한 배추무름병균은 스트렙토마이신 저항성인 균주가 없었으나, 이전 연구에서는 배추, 무에서 분리한 76개의 무름병 균주 중 5개 균주가 스트렙토마이신 저항성인 것으로 조사된 바 있다(Kim et al., 2021). 현재 국내에는 배추 검은썩음병 방제를 위해 등록된 약제는 없으나, 스트렙토마이신이 함유된 살균제가 배추 무름병 방제에 사용되고 있다. Stall and Thayer (1962)에 연구에 의해 스트렙토마이신 저항성 세균점무늬병균(X. campestris pv. vesicatoria)의 발생이 처음 보고되었으며, 이 후 Xu et al. (2013)에 의해 벼 흰잎마름병균(X. oryzae pv. oryzae)의 스트렙토마이신 저항성균주가 보고되었다. 본 연구에서 분리된 저항성 검은썩음병균의 경우, 배추 재배지에서 무름병 방제를 위해 스트렙토마이신 등의 약제 살포가 빈번히 이루어진 것이 저항성균이 출현한 원인으로 생각되며, 향후 여러 지역과 포장에서 검은썩음병균을 분리하여 저항성을 모니터링할 필요가 있다.

저항성 균주의 유전자 변이 분석

배추에서 분리한 스트렙토마이신 저항성 균주의 strAstrB 유전자의 삽입 여부를 확인한 결과, 두 유전자의 삽입은 확인되지 않았다(Fig. 3A). 따라서 또 다른 기작 중 하나인 rpsL 유전자의 염기서열을 분석한 결과 88번 아미노산 부위에서 라이신(AAG)이 아르기닌(AGG)으로 변이가 발생한 것을 확인하였다(Table 5). Xanthomonas속의 스트렙토마이신 저항성균주는 rpsL 유전자의 단일염기변이에 의해 43번 또는 88번 아미노산이 치환되면서 저항성을 획득하는 것으로 알려져 있다(Zhang et al., 2015). 따라서 본 연구에서 분리된 스트렙토마이신 저항성 검은썩음병균(XccSmR)은 strAstrB 유전자의 삽입이 없고, rpsL 유전자의 88번 아미노산이 치환되면서 저항성을 획득한 것으로 나타났다. 본 저항성 균주의 최소 억제농도를 확인한 결과, 스트렙토마이신 2,500 μg/ml 이상에서도 억제되지 않는 것으로 나타났다(Fig. 3D). 기존 연구에 의하면 rpsL 유전자의 염기서열 변이에 의해 스트렙토마이신 저항성을 획득한 E. amylovora 등의 병원균 역시 MIC 농도가 2,000 μg/ml 이상인 것으로 보고되었다(Chiou and Jones 1995; McManus et al., 2002). 향후 국내 균주의 MIC 농도를 구하기 위해서 더 높은 농도에서의 조사가 필요할 것으로 생각된다.

Table 5. 
Difference in rpsL sequence between the streptomycin-sensitive and -resistant isolates of Xanthomonas campestris pv. campestris
Strain SmRa) Sequence
8004 - CCGTGGTCCTGATTCGTGGTGGTCGCGTCAAGGATCTTCCCGGTGT
MAFF302021 - CCGTGGTCCTGATTCGTGGTGGTCGCGTCAAGGATCTTCCCGGTGT
3811 - CCGTGGTCCTGATTCGTGGTGGTCGCGTCAAGGATCTTCCCGGTGT
XccSmR + CCGTGGTCCTGATTCGTGGTGGTCGCGTCAGGGATCTTCCCGGTGT
a ) Absence (-) or presence (+) of streptomycin resistance

본 연구에서는 국내 배추 재배지에서 분리한 검은썩음병균의 스트렙토마이신 저항성균을 국내에서 처음으로 분리하였고, 게놈 내 단일염기변이를 확인하였다. 이는 배추 무름병 방제를 위한 지속적인 항생제의 살포가 방제 대상 병원균인 무름병뿐만 아니라 검은썩음병균이 항생제 저항성 획득할 수 있다는 가능성을 나타낸다. 따라서 배추 무름병의 방제를 위해 사용하는 항생제를 계통별로 교호 살포하고, 무름병 뿐만 아니라 검은썩음병, 세균검은무늬병 등의 세균병을 대상으로 항생제 저항성 모니터링을 지속적으로 실시하며, 효과적인 미생물 제제의 개발을 추진하는 등 항생제 저항성 관리를 위한 종합적 대책 마련이 필요할 것으로 판단된다.


Acknowledgments

본 연구는 농촌진흥청 국립농업과학원 연구과제(PJ01724203)의 지원으로 수행되었습니다. 무름병균과 검은썩음병균을 분양하여 주신 국립농업과학원 농업미생물은행에 감사드립니다.

이해상충관계

저자들은 이행상충관계가 없음을 선언합니다.


References
1. The Plant Pathology Journal, 2022, List of Plant Diseases in Korea, Korea. (In Korean)
2. Rural Development Administration, 2023, Regulation of pesticide toxicity. http://psis.rda.go.kr/psis/agc/res/agchmregistStusLst.ps (Accessed Oct. 10. 2023).
3. Bhat NA, Masoodi SD, Sidique SH, 2000. Chemical control of black rot of cabbage under field conditions in Kashmir valley. Appl. Biol. Res. 2(1/2):87-89.
4. Chan JWYF, Goodwin PH, 1999. The molecular genetics of virulence of Xanthomonas campestris. Biotechnol. Adv. 17(6):489-508.
5. Chiou CS, Jones AL, 1995. Molecular analysis of high-level streptomycin resistance in Erwinia amylovora. Mol. Plant Pathol. 85:324-328.
6. Cook AA, Larson RH, Walker JC, 1952. Relation of the black rot pathogen to Cabbage seed. Phytopathology. 42(6):316-320
7. Jee S, Choi JG, Lee YG, Kwon M, Hwang I, et al., 2020. Distribution of Pectobacterium species isolated in South Korea and comparison of temperature effects on pathogenicity. Plant Pathol. J. 36(4):346-354.
8. Kim D, Kim N, Kim C, Jeong MI, Oh KK, et al., 2021. Investigation of antimicrobial minimum inhibitory concentration of Pectobacterium spp. isolated from agricultural produce. Korean J. Pestic. Sci. 25(4):333-342.
9. Knosel D, 1965. On the effectiveness of antibiotics and other preparations against Xanthomonas campestris pv. campestris on cabbage. Phytopath. Z. 54:31-39.
10. Lee DH, Kim JB, Lim JA, Han SW, Heu S, 2014. Genetic diversity of Pectobacterium carotovorum subsp. brasiliensis isolated in Korea. Plant Pathol. J. 30(2):117-124.
11. Lee M-H, Ham H, Choi H-W, Park DS. 2023. Isolation of streptomycin-resistant Erwinia pyrifoliae in Korea. Plant Dis. 107(3):616-619.
12. Lee YS, Kim GH, Song YR, Oh CS, Koh YJ, et al., 2020. Streptomycin resistant isolates of Pseudomonas syringae pv. actinidiae in Korea. Research in Plant Dis. 26(1):44-47.
13. Ma B, Hibbing ME, Kim HS, Reedy RM, Yedidia I, et al., 2007. Host range and molecular phylogenies of the soft rot enterobacterial genera Pectobacterium and Dickeya. Phytopathology. 97(9):1150-1163.
14. McManus PS, Stockwell VO, Sundin GW, Jones AL. 2002. Antibiotic use in plant agriculture. Annu. Rev. Phytopathol. 40:443-465.
15. Park D, Kim J, Lee H, Hahm Y, Lim C, 1999. Black leg of potato plants by Erwinia carotovora subsp. atroseptica. Plant Dis. and Agricul. 5(1):64-66.
16. Roh EJ, Lee SD, Lee YH, Ra DS, Choi JH, et al., 2009. Diverse antibacterial activity of Pectobacterium carotovorum subsp. carotovorum isolated in Korea. J. Microbial. Biotechnol. 19(1):42-50.
17. Stall RE, 1962. Streptomycin resistance of the bacterial spot pathogen and control with streptomycin. Plant Dis. Rep. 46:389-392.
18. Sanko TJ, Kraemer AS, Niemann N, Gupta AK, Flett BC, et al., 2018. Draft geonome assemblages of 10 Xanthomonas vasicola pv. zeae strains, pathogens causing leaf streak disease of maize in South Africa. Genome Announcements. 6(26):e00532-18.
19. Scheck HJ, Pscheidt JW, Moore LW. 1996. Copper and streptomycin resistance in strains of Pseudomonas syringae from Pacific Northwest nurseries. Plant Dis. 80:1034-1039.
20. Seo ST, Koo JH, Hur JH, Lim CK, 2004. Characterization of Korean Erwinia carotovora strains from potato and Chinese cabbage. Plant Pathol. J. 20(4):283-288.
21. Sharma J, Manjunatha N, Pokhare SS, Patil PG, Agarrwal R, et al., 2022. Genetic diversity and streptomycin sensitivity in Xanthomonas axonopodis pv. punicae causing oily spot disease in pomegranates. Horticulture. 8(5):441.
22. Sundin GW, Bender CL, 1993. Ecological and genetic analysis of copper and streptomycin resistance in Pseudomonas syringae pv. syringae. Appl. Environ. Microbiol. 59(4):1018-1024.
23. Sundin, GW, Wang N, 2018. Antibiotic resistance in plant-pathogenic bacteria. Annu. Rev. Phytopathol. 56:161-180.
24. The Korean Society of Plant Pathology, 2022. List of Plant Disease in Korea. (In Korean)
25. Velasco P, Lema M, Francisco M, Soengas P, Cartea ME, 2013. In vivo and in vitro effects of secondary metabolites against Xanthomonas campestris pv. campestris. Molecules. 18(9):11131-11143.
26. Vicente JG, Holub EB, 2013. Xanthomonas campestris pv. campestris (cause of black rot of crucifers) in the genomic era is still a worldwide threat to brassica crops. Mol. Plant Pathol. 14(1): 2-18.
27. Williams PH, 1980. Black rot: a continuing threat to world crucifers. Plant Dis. 64(8):736-742.
28. Xu Y, Luo Q, Zhou M, 2013. Identification and characterization of integron-mediated antibiotic resistance in the phytopathogen Xanthomonas oryzae pv. oryzae. PLOS. 8(2):e55962.
29. Zhang Y, Chen Y, Zhu X, Xu Y, Hou Y, et al., 2011. A molecular mechanism of resistance to streptomycin in Xanthomonas oryzea pv. oryzicola. Phytoparastitica. 39:393-401.
30. Zhang Y, Yang X, Zhou FY, Zhang AF, Zhu XF, et al., 2015. Detection of a mutation at codon 43 of the rpsL gene in Xanthomonas oryzae pv. oryzicola and X. oryzae pv. oryzae by PCR-RFLP. Genet. and Mol. Res. 14(4):18587-18595.

Author Information and Contributions

Mi-Hyun Lee designed and coordinated all the experiments. Mi-Hyun Lee, Hyo-Won Choi, Yong Hwan Lee, Sung kee Hong performed cultivation, DNA extraction, and purification. Hyoung-Rai Ko performed the genomic analysis. Mi-Hyun Lee wrote the manuscript. All authors have read and approved the manuscript.

Mi-Hyun Lee, NAS, RDA, Researcher, https://orcid.org/0000-0002-9385-8393

Hyoung-Rai Ko, NAS, RDA, Researcher, https://orcid.org/0000-0002-0643-6986

Yong Hwan Lee, NAS, RDA, Senior researcher, https://orcid.org/0000-0002-1721-991X

Sung kee Hong, NAS, RDA, Senior researcher, https://orcid.org/0000-0003-4204-8371

Hyo-Won Choi, RDA, Researcher, https://orcid.org/0000-0002-3496-3855